Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638200_at:

>probe:Drosophila_2:1638200_at:658:705; Interrogation_Position=11179; Antisense; TTAGACTGATTTTTTCTACACACAT
>probe:Drosophila_2:1638200_at:467:689; Interrogation_Position=11227; Antisense; TTTGAGAAGTCCCAGCCAATTGCCT
>probe:Drosophila_2:1638200_at:187:427; Interrogation_Position=11262; Antisense; GAGTTGCAGCAAACGGAGTCCTAAT
>probe:Drosophila_2:1638200_at:594:653; Interrogation_Position=11283; Antisense; TAATCCCAATCCCAACTAGCGATTT
>probe:Drosophila_2:1638200_at:169:311; Interrogation_Position=11294; Antisense; CCAACTAGCGATTTACATGTACATA
>probe:Drosophila_2:1638200_at:278:173; Interrogation_Position=11344; Antisense; AAAGCTACAGTTGTCGGCCTATCCG
>probe:Drosophila_2:1638200_at:667:91; Interrogation_Position=11352; Antisense; AGTTGTCGGCCTATCCGAATCCGAT
>probe:Drosophila_2:1638200_at:45:365; Interrogation_Position=11368; Antisense; GAATCCGATCGTTCCGTTCGTTCGA
>probe:Drosophila_2:1638200_at:506:297; Interrogation_Position=11381; Antisense; CCGTTCGTTCGATGAGTATATACCA
>probe:Drosophila_2:1638200_at:676:69; Interrogation_Position=11413; Antisense; AGGCGTATACACACTATATAGCCAC
>probe:Drosophila_2:1638200_at:709:21; Interrogation_Position=11428; Antisense; ATATAGCCACATGCCCAATTAGCCA
>probe:Drosophila_2:1638200_at:44:323; Interrogation_Position=11440; Antisense; GCCCAATTAGCCAAATCTCTCATTA
>probe:Drosophila_2:1638200_at:528:491; Interrogation_Position=11473; Antisense; GTAAATGCTAATTTCTCACCAAGAG
>probe:Drosophila_2:1638200_at:693:419; Interrogation_Position=11495; Antisense; GAGCAGACAAATTTTCTTACGATTA

Paste this into a BLAST search page for me
TTAGACTGATTTTTTCTACACACATTTTGAGAAGTCCCAGCCAATTGCCTGAGTTGCAGCAAACGGAGTCCTAATTAATCCCAATCCCAACTAGCGATTTCCAACTAGCGATTTACATGTACATAAAAGCTACAGTTGTCGGCCTATCCGAGTTGTCGGCCTATCCGAATCCGATGAATCCGATCGTTCCGTTCGTTCGACCGTTCGTTCGATGAGTATATACCAAGGCGTATACACACTATATAGCCACATATAGCCACATGCCCAATTAGCCAGCCCAATTAGCCAAATCTCTCATTAGTAAATGCTAATTTCTCACCAAGAGGAGCAGACAAATTTTCTTACGATTA

Full Affymetrix probeset data:

Annotations for 1638200_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime