Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638201_at:

>probe:Drosophila_2:1638201_at:605:435; Interrogation_Position=1324; Antisense; GAGGATTTCCGCGTGTACCAGTGGA
>probe:Drosophila_2:1638201_at:551:487; Interrogation_Position=1338; Antisense; GTACCAGTGGATGCTGCAGTCCGGC
>probe:Drosophila_2:1638201_at:104:83; Interrogation_Position=1382; Antisense; AGTACGGTCCCTATCTGGGCCAGGA
>probe:Drosophila_2:1638201_at:457:77; Interrogation_Position=1403; Antisense; AGGATGGCTACTGTCACGTCAACAA
>probe:Drosophila_2:1638201_at:286:185; Interrogation_Position=1423; Antisense; AACAACGTGACGCTGGTGGCACCTA
>probe:Drosophila_2:1638201_at:462:229; Interrogation_Position=1462; Antisense; AATGTGACCTCCAACGATCCAAATG
>probe:Drosophila_2:1638201_at:669:273; Interrogation_Position=1530; Antisense; CATTGATGCTTCTCCCAAGACATTT
>probe:Drosophila_2:1638201_at:140:213; Interrogation_Position=1546; Antisense; AAGACATTTAGCTTCTACTCGCACG
>probe:Drosophila_2:1638201_at:718:427; Interrogation_Position=1571; Antisense; GAGTTTACTATGAGCCAACGTGCAA
>probe:Drosophila_2:1638201_at:180:143; Interrogation_Position=1611; Antisense; ACTGGATCATGCTGTCTTGGCCGTG
>probe:Drosophila_2:1638201_at:665:581; Interrogation_Position=1628; Antisense; TGGCCGTGGGCTATGGCTCGATCAA
>probe:Drosophila_2:1638201_at:141:375; Interrogation_Position=1674; Antisense; GAAGAACTCGTGGTCCACCTACTGG
>probe:Drosophila_2:1638201_at:577:5; Interrogation_Position=1739; Antisense; ATTGCGGTGTTATGACCATGCCCAC
>probe:Drosophila_2:1638201_at:516:587; Interrogation_Position=1769; Antisense; TGGAGATGTAGATTGTCCCGCTCCC

Paste this into a BLAST search page for me
GAGGATTTCCGCGTGTACCAGTGGAGTACCAGTGGATGCTGCAGTCCGGCAGTACGGTCCCTATCTGGGCCAGGAAGGATGGCTACTGTCACGTCAACAAAACAACGTGACGCTGGTGGCACCTAAATGTGACCTCCAACGATCCAAATGCATTGATGCTTCTCCCAAGACATTTAAGACATTTAGCTTCTACTCGCACGGAGTTTACTATGAGCCAACGTGCAAACTGGATCATGCTGTCTTGGCCGTGTGGCCGTGGGCTATGGCTCGATCAAGAAGAACTCGTGGTCCACCTACTGGATTGCGGTGTTATGACCATGCCCACTGGAGATGTAGATTGTCCCGCTCCC

Full Affymetrix probeset data:

Annotations for 1638201_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime