FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638202_at:

>probe:Drosophila_2:1638202_at:297:455; Interrogation_Position=1006; Antisense; GATCAACGCAAGACGTCCAGTGCCG
>probe:Drosophila_2:1638202_at:369:487; Interrogation_Position=469; Antisense; GTAGCCGTGGCCAATGTGTTTGATA
>probe:Drosophila_2:1638202_at:623:457; Interrogation_Position=490; Antisense; GATAGCATCGATGAGCTCTCCATTC
>probe:Drosophila_2:1638202_at:430:439; Interrogation_Position=591; Antisense; GATGTGCATCGAACGGGTCATGGAC
>probe:Drosophila_2:1638202_at:28:649; Interrogation_Position=635; Antisense; TCATGGATGAGGTTCTGCCGCTGCT
>probe:Drosophila_2:1638202_at:310:9; Interrogation_Position=673; Antisense; ATTCCCGATCCCGATATTATCATGC
>probe:Drosophila_2:1638202_at:505:669; Interrogation_Position=699; Antisense; TACTGTGCGCATCTACCATAAACTG
>probe:Drosophila_2:1638202_at:727:691; Interrogation_Position=724; Antisense; TTTGTGGACAAAACCTACGGACTGA
>probe:Drosophila_2:1638202_at:119:509; Interrogation_Position=799; Antisense; GTGAATCCTTCACTTAATTTCGAGC
>probe:Drosophila_2:1638202_at:358:243; Interrogation_Position=824; Antisense; AATATTGCTACCTGCTGGAGGTGCT
>probe:Drosophila_2:1638202_at:7:679; Interrogation_Position=860; Antisense; TAGAGGCCATCGATCGGCAGCAGAG
>probe:Drosophila_2:1638202_at:363:207; Interrogation_Position=895; Antisense; AAGCTGGACAACCTGTCGATGGCCT
>probe:Drosophila_2:1638202_at:414:471; Interrogation_Position=951; Antisense; GTTCTCCACGGACAACATGAATGCG
>probe:Drosophila_2:1638202_at:467:243; Interrogation_Position=985; Antisense; AATATTCCCAACTTGCGTATTGATC

Paste this into a BLAST search page for me
GATCAACGCAAGACGTCCAGTGCCGGTAGCCGTGGCCAATGTGTTTGATAGATAGCATCGATGAGCTCTCCATTCGATGTGCATCGAACGGGTCATGGACTCATGGATGAGGTTCTGCCGCTGCTATTCCCGATCCCGATATTATCATGCTACTGTGCGCATCTACCATAAACTGTTTGTGGACAAAACCTACGGACTGAGTGAATCCTTCACTTAATTTCGAGCAATATTGCTACCTGCTGGAGGTGCTTAGAGGCCATCGATCGGCAGCAGAGAAGCTGGACAACCTGTCGATGGCCTGTTCTCCACGGACAACATGAATGCGAATATTCCCAACTTGCGTATTGATC

Full Affymetrix probeset data:

Annotations for 1638202_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720