FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638203_at:

>probe:Drosophila_2:1638203_at:196:267; Interrogation_Position=442; Antisense; CAGGCCTGGGTTTGGGAATATCCGC
>probe:Drosophila_2:1638203_at:313:365; Interrogation_Position=457; Antisense; GAATATCCGCTCGAGGATGGCGCCA
>probe:Drosophila_2:1638203_at:335:77; Interrogation_Position=470; Antisense; AGGATGGCGCCAAACACGATCTCTT
>probe:Drosophila_2:1638203_at:455:137; Interrogation_Position=485; Antisense; ACGATCTCTTCATGGACGTTGGCGA
>probe:Drosophila_2:1638203_at:532:579; Interrogation_Position=504; Antisense; TGGCGAGCCCATTAAGTTCCGCGTA
>probe:Drosophila_2:1638203_at:92:471; Interrogation_Position=519; Antisense; GTTCCGCGTATCACGGGAGATCTTC
>probe:Drosophila_2:1638203_at:207:453; Interrogation_Position=537; Antisense; GATCTTCGAGGAAACATCGCCCATT
>probe:Drosophila_2:1638203_at:654:689; Interrogation_Position=560; Antisense; TTGGACCACCGAAAACTGAGGCTCA
>probe:Drosophila_2:1638203_at:72:83; Interrogation_Position=593; Antisense; AGGGAGCTAGCACATCCGCTGCAGT
>probe:Drosophila_2:1638203_at:103:347; Interrogation_Position=619; Antisense; GCATCAGCTACCTCCCAAGAAGTGA
>probe:Drosophila_2:1638203_at:553:523; Interrogation_Position=664; Antisense; GGTGCCATTAACGAATCCGGCCTAG
>probe:Drosophila_2:1638203_at:207:295; Interrogation_Position=783; Antisense; CGAAGAATGATCCTGACGCCTACTC
>probe:Drosophila_2:1638203_at:353:411; Interrogation_Position=797; Antisense; GACGCCTACTCCTTTGTATAGATGC
>probe:Drosophila_2:1638203_at:187:603; Interrogation_Position=909; Antisense; TGATTTTCAGACCATACCATACCAT

Paste this into a BLAST search page for me
CAGGCCTGGGTTTGGGAATATCCGCGAATATCCGCTCGAGGATGGCGCCAAGGATGGCGCCAAACACGATCTCTTACGATCTCTTCATGGACGTTGGCGATGGCGAGCCCATTAAGTTCCGCGTAGTTCCGCGTATCACGGGAGATCTTCGATCTTCGAGGAAACATCGCCCATTTTGGACCACCGAAAACTGAGGCTCAAGGGAGCTAGCACATCCGCTGCAGTGCATCAGCTACCTCCCAAGAAGTGAGGTGCCATTAACGAATCCGGCCTAGCGAAGAATGATCCTGACGCCTACTCGACGCCTACTCCTTTGTATAGATGCTGATTTTCAGACCATACCATACCAT

Full Affymetrix probeset data:

Annotations for 1638203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720