FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638206_at:

>probe:Drosophila_2:1638206_at:617:671; Interrogation_Position=104; Antisense; TACGCTGATGTTTCCGAGCCGGCTG
>probe:Drosophila_2:1638206_at:644:605; Interrogation_Position=109; Antisense; TGATGTTTCCGAGCCGGCTGCCGGA
>probe:Drosophila_2:1638206_at:408:157; Interrogation_Position=16; Antisense; ACAAATCAACTTGTGATCCAAGCAG
>probe:Drosophila_2:1638206_at:405:131; Interrogation_Position=160; Antisense; ACCGGCGCCTGTGAAGAGCTACATT
>probe:Drosophila_2:1638206_at:436:729; Interrogation_Position=26; Antisense; TTGTGATCCAAGCAGCAACAAGCCC
>probe:Drosophila_2:1638206_at:544:571; Interrogation_Position=325; Antisense; GGCTCCAGTTGCTCCCGTGGAGACC
>probe:Drosophila_2:1638206_at:175:187; Interrogation_Position=42; Antisense; AACAAGCCCATCTCCTCAAGATGAA
>probe:Drosophila_2:1638206_at:602:495; Interrogation_Position=486; Antisense; GTCACCGCAACTAAGTCTGTGTCCC
>probe:Drosophila_2:1638206_at:652:641; Interrogation_Position=501; Antisense; TCTGTGTCCCCCAATTGTTGACTAA
>probe:Drosophila_2:1638206_at:650:725; Interrogation_Position=518; Antisense; TTGACTAATGTGATAGGCCCCAGGC
>probe:Drosophila_2:1638206_at:251:23; Interrogation_Position=530; Antisense; ATAGGCCCCAGGCAATGTTCACCTT
>probe:Drosophila_2:1638206_at:425:229; Interrogation_Position=543; Antisense; AATGTTCACCTTGCCCAGGTATCAG
>probe:Drosophila_2:1638206_at:696:321; Interrogation_Position=555; Antisense; GCCCAGGTATCAGTTAATGTTTTCT
>probe:Drosophila_2:1638206_at:354:445; Interrogation_Position=61; Antisense; GATGAAATTCCTTATCATTGCCGTC

Paste this into a BLAST search page for me
TACGCTGATGTTTCCGAGCCGGCTGTGATGTTTCCGAGCCGGCTGCCGGAACAAATCAACTTGTGATCCAAGCAGACCGGCGCCTGTGAAGAGCTACATTTTGTGATCCAAGCAGCAACAAGCCCGGCTCCAGTTGCTCCCGTGGAGACCAACAAGCCCATCTCCTCAAGATGAAGTCACCGCAACTAAGTCTGTGTCCCTCTGTGTCCCCCAATTGTTGACTAATTGACTAATGTGATAGGCCCCAGGCATAGGCCCCAGGCAATGTTCACCTTAATGTTCACCTTGCCCAGGTATCAGGCCCAGGTATCAGTTAATGTTTTCTGATGAAATTCCTTATCATTGCCGTC

Full Affymetrix probeset data:

Annotations for 1638206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720