Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638207_at:

>probe:Drosophila_2:1638207_at:140:455; Interrogation_Position=114; Antisense; GATAATGAGCTTTTACGACGCGATG
>probe:Drosophila_2:1638207_at:488:637; Interrogation_Position=173; Antisense; TCGAGCCGCTGACCATTGTGAATGT
>probe:Drosophila_2:1638207_at:73:97; Interrogation_Position=254; Antisense; AGATCAATGATGTGCCGGCCCTGGA
>probe:Drosophila_2:1638207_at:611:97; Interrogation_Position=278; Antisense; AGATGACCTTCAATGAGGCCCTGCA
>probe:Drosophila_2:1638207_at:37:439; Interrogation_Position=292; Antisense; GAGGCCCTGCAAATGTTCCGAAAGA
>probe:Drosophila_2:1638207_at:701:245; Interrogation_Position=316; Antisense; AATTCGCGATACGTTCGTGTCTACG
>probe:Drosophila_2:1638207_at:403:465; Interrogation_Position=373; Antisense; GATTGGACCTGCGATTGCTGGTTTA
>probe:Drosophila_2:1638207_at:585:13; Interrogation_Position=433; Antisense; ATTCAATGGACATTCCCCTGGAACG
>probe:Drosophila_2:1638207_at:215:361; Interrogation_Position=464; Antisense; GCAAGCCTGTCTACAAGGAGTCCAA
>probe:Drosophila_2:1638207_at:376:77; Interrogation_Position=479; Antisense; AGGAGTCCAATTGCTTCATGGTGCC
>probe:Drosophila_2:1638207_at:277:215; Interrogation_Position=520; Antisense; AAGATTCGGGCGAGACGTGCTGCCA
>probe:Drosophila_2:1638207_at:169:627; Interrogation_Position=540; Antisense; TGCCACCTCAGCTGTTCACAAAAAG
>probe:Drosophila_2:1638207_at:265:365; Interrogation_Position=615; Antisense; GAATCAACCAGGTCCGAATCTTCTC
>probe:Drosophila_2:1638207_at:184:367; Interrogation_Position=630; Antisense; GAATCTTCTCGAGACCGTGCTCAGG

Paste this into a BLAST search page for me
GATAATGAGCTTTTACGACGCGATGTCGAGCCGCTGACCATTGTGAATGTAGATCAATGATGTGCCGGCCCTGGAAGATGACCTTCAATGAGGCCCTGCAGAGGCCCTGCAAATGTTCCGAAAGAAATTCGCGATACGTTCGTGTCTACGGATTGGACCTGCGATTGCTGGTTTAATTCAATGGACATTCCCCTGGAACGGCAAGCCTGTCTACAAGGAGTCCAAAGGAGTCCAATTGCTTCATGGTGCCAAGATTCGGGCGAGACGTGCTGCCATGCCACCTCAGCTGTTCACAAAAAGGAATCAACCAGGTCCGAATCTTCTCGAATCTTCTCGAGACCGTGCTCAGG

Full Affymetrix probeset data:

Annotations for 1638207_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime