Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638208_at:

>probe:Drosophila_2:1638208_at:376:547; Interrogation_Position=2290; Antisense; GGATGCGCCGATTGAGTGCGTTTTT
>probe:Drosophila_2:1638208_at:130:87; Interrogation_Position=2304; Antisense; AGTGCGTTTTTCTAGAGTGCGGACA
>probe:Drosophila_2:1638208_at:301:677; Interrogation_Position=2316; Antisense; TAGAGTGCGGACACATGGCCACCTG
>probe:Drosophila_2:1638208_at:88:389; Interrogation_Position=2352; Antisense; GAAAAGTGTTGAACGAGTGCCCAAT
>probe:Drosophila_2:1638208_at:274:433; Interrogation_Position=2366; Antisense; GAGTGCCCAATTTGCCGACAATATA
>probe:Drosophila_2:1638208_at:657:453; Interrogation_Position=2424; Antisense; GATACGGCTAATCTTACGGTAACTG
>probe:Drosophila_2:1638208_at:617:57; Interrogation_Position=2460; Antisense; ATGATGGAAGCCGATAGCCGCCACA
>probe:Drosophila_2:1638208_at:219:457; Interrogation_Position=2472; Antisense; GATAGCCGCCACAAGCTACATACAG
>probe:Drosophila_2:1638208_at:273:449; Interrogation_Position=2502; Antisense; GATCCAGCCCAGCTGTACAAGTTGT
>probe:Drosophila_2:1638208_at:244:449; Interrogation_Position=2533; Antisense; GATCCTGATGATGCGACTACAACGT
>probe:Drosophila_2:1638208_at:156:403; Interrogation_Position=2547; Antisense; GACTACAACGTATATGTTTCCTTAA
>probe:Drosophila_2:1638208_at:528:479; Interrogation_Position=2562; Antisense; GTTTCCTTAAATGACGCGAGTGCAA
>probe:Drosophila_2:1638208_at:220:541; Interrogation_Position=2610; Antisense; GGTTCTTCTCTGTAGTATGTTGCCA
>probe:Drosophila_2:1638208_at:108:389; Interrogation_Position=2832; Antisense; GAAAAACTCGTCTAGATGCGCATTT

Paste this into a BLAST search page for me
GGATGCGCCGATTGAGTGCGTTTTTAGTGCGTTTTTCTAGAGTGCGGACATAGAGTGCGGACACATGGCCACCTGGAAAAGTGTTGAACGAGTGCCCAATGAGTGCCCAATTTGCCGACAATATAGATACGGCTAATCTTACGGTAACTGATGATGGAAGCCGATAGCCGCCACAGATAGCCGCCACAAGCTACATACAGGATCCAGCCCAGCTGTACAAGTTGTGATCCTGATGATGCGACTACAACGTGACTACAACGTATATGTTTCCTTAAGTTTCCTTAAATGACGCGAGTGCAAGGTTCTTCTCTGTAGTATGTTGCCAGAAAAACTCGTCTAGATGCGCATTT

Full Affymetrix probeset data:

Annotations for 1638208_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime