Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638210_at:

>probe:Drosophila_2:1638210_at:533:591; Interrogation_Position=1370; Antisense; TGGGAACGGAAATCCACTCCACGAG
>probe:Drosophila_2:1638210_at:697:281; Interrogation_Position=1396; Antisense; CTCCAATCTCTGCTGGCGCATAAAA
>probe:Drosophila_2:1638210_at:718:183; Interrogation_Position=1418; Antisense; AAAAGGCGAAGCTGCTGCGTTTTAT
>probe:Drosophila_2:1638210_at:224:477; Interrogation_Position=1436; Antisense; GTTTTATGTTGTCACGTTGGCTTCA
>probe:Drosophila_2:1638210_at:431:695; Interrogation_Position=1486; Antisense; TTTCCAACCATATATCACTGCACCA
>probe:Drosophila_2:1638210_at:34:397; Interrogation_Position=1614; Antisense; GAAATTTATGATGTGCCGGTGCCTT
>probe:Drosophila_2:1638210_at:164:291; Interrogation_Position=1630; Antisense; CGGTGCCTTATGAATCGTGCGGATT
>probe:Drosophila_2:1638210_at:416:573; Interrogation_Position=1669; Antisense; GGCTGCATGAATATCGTGTACTCCT
>probe:Drosophila_2:1638210_at:387:601; Interrogation_Position=1685; Antisense; TGTACTCCTTTTTCCTCTTTCAATT
>probe:Drosophila_2:1638210_at:174:1; Interrogation_Position=1706; Antisense; AATTTTGGGCGGTGGAACTCTTCAG
>probe:Drosophila_2:1638210_at:386:193; Interrogation_Position=1721; Antisense; AACTCTTCAGATCCCTCAACAATTA
>probe:Drosophila_2:1638210_at:538:443; Interrogation_Position=1785; Antisense; GATGTTCAATGTGATCGCCATGATA
>probe:Drosophila_2:1638210_at:480:217; Interrogation_Position=1827; Antisense; AAGTATCTCGGTCTTCTACTGGATG
>probe:Drosophila_2:1638210_at:689:163; Interrogation_Position=1924; Antisense; AAATATTCGTTGTACCGCGTTTGCA

Paste this into a BLAST search page for me
TGGGAACGGAAATCCACTCCACGAGCTCCAATCTCTGCTGGCGCATAAAAAAAAGGCGAAGCTGCTGCGTTTTATGTTTTATGTTGTCACGTTGGCTTCATTTCCAACCATATATCACTGCACCAGAAATTTATGATGTGCCGGTGCCTTCGGTGCCTTATGAATCGTGCGGATTGGCTGCATGAATATCGTGTACTCCTTGTACTCCTTTTTCCTCTTTCAATTAATTTTGGGCGGTGGAACTCTTCAGAACTCTTCAGATCCCTCAACAATTAGATGTTCAATGTGATCGCCATGATAAAGTATCTCGGTCTTCTACTGGATGAAATATTCGTTGTACCGCGTTTGCA

Full Affymetrix probeset data:

Annotations for 1638210_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime