FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638211_at:

>probe:Drosophila_2:1638211_at:346:173; Interrogation_Position=1034; Antisense; AAAGCGCAAGCTCCAGACGATCTGT
>probe:Drosophila_2:1638211_at:98:453; Interrogation_Position=1052; Antisense; GATCTGTACCTTTCTGTGCGGAGAG
>probe:Drosophila_2:1638211_at:665:583; Interrogation_Position=1121; Antisense; TGGCTTTGGGCTTATGCTCCGAAAA
>probe:Drosophila_2:1638211_at:633:589; Interrogation_Position=1156; Antisense; TGGATTCATCCCGAAAGCCTATGCC
>probe:Drosophila_2:1638211_at:14:583; Interrogation_Position=622; Antisense; TGGCTCCGCCAACAGCATAGAGAAC
>probe:Drosophila_2:1638211_at:490:101; Interrogation_Position=640; Antisense; AGAGAACACCCTGCTGGTGGAGCCA
>probe:Drosophila_2:1638211_at:2:127; Interrogation_Position=660; Antisense; AGCCAGAGTGTACTCCTTTCGTGAA
>probe:Drosophila_2:1638211_at:78:485; Interrogation_Position=702; Antisense; GTATCGTCTTGTACACCTTTATAGC
>probe:Drosophila_2:1638211_at:609:475; Interrogation_Position=767; Antisense; GTTACCGTGCTAAATCGCGAGGATC
>probe:Drosophila_2:1638211_at:484:73; Interrogation_Position=825; Antisense; AGGAAGGATTTGTGCCAGCCAGCTT
>probe:Drosophila_2:1638211_at:581:261; Interrogation_Position=840; Antisense; CAGCCAGCTTTATTTATCCTGCAGA
>probe:Drosophila_2:1638211_at:90:401; Interrogation_Position=863; Antisense; GACAGTGTACGAGTTTTGCAGCAAC
>probe:Drosophila_2:1638211_at:234:155; Interrogation_Position=955; Antisense; ACAGCAGCAGCCTCAATTGGGCTTG
>probe:Drosophila_2:1638211_at:679:605; Interrogation_Position=988; Antisense; TGATCTACGCTACCATGGCACGGAG

Paste this into a BLAST search page for me
AAAGCGCAAGCTCCAGACGATCTGTGATCTGTACCTTTCTGTGCGGAGAGTGGCTTTGGGCTTATGCTCCGAAAATGGATTCATCCCGAAAGCCTATGCCTGGCTCCGCCAACAGCATAGAGAACAGAGAACACCCTGCTGGTGGAGCCAAGCCAGAGTGTACTCCTTTCGTGAAGTATCGTCTTGTACACCTTTATAGCGTTACCGTGCTAAATCGCGAGGATCAGGAAGGATTTGTGCCAGCCAGCTTCAGCCAGCTTTATTTATCCTGCAGAGACAGTGTACGAGTTTTGCAGCAACACAGCAGCAGCCTCAATTGGGCTTGTGATCTACGCTACCATGGCACGGAG

Full Affymetrix probeset data:

Annotations for 1638211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720