FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638214_at:

>probe:Drosophila_2:1638214_at:701:75; Interrogation_Position=410; Antisense; AGGAGTCACCGCAATTGTTGGCGAA
>probe:Drosophila_2:1638214_at:219:373; Interrogation_Position=432; Antisense; GAAGGTGCATCCGATACGCGCTGAT
>probe:Drosophila_2:1638214_at:728:603; Interrogation_Position=453; Antisense; TGATTACAGTGCCATCGACCTGGAC
>probe:Drosophila_2:1638214_at:31:637; Interrogation_Position=467; Antisense; TCGACCTGGACATTGATTCCGCCGA
>probe:Drosophila_2:1638214_at:700:231; Interrogation_Position=498; Antisense; AATGCTCTCGTCTGAGGTCCAGTGC
>probe:Drosophila_2:1638214_at:634:85; Interrogation_Position=518; Antisense; AGTGCCTGGCATGCGCGAGCTATTG
>probe:Drosophila_2:1638214_at:43:505; Interrogation_Position=596; Antisense; GTCCGCATCCGTTGATTGTCTTTAA
>probe:Drosophila_2:1638214_at:630:713; Interrogation_Position=611; Antisense; TTGTCTTTAATGTTGTCGCTTCGGT
>probe:Drosophila_2:1638214_at:319:401; Interrogation_Position=667; Antisense; GACATTAATGTCCTGGGCACGAAAA
>probe:Drosophila_2:1638214_at:451:347; Interrogation_Position=720; Antisense; GCACTTGAAGATCTACCGCACATTT
>probe:Drosophila_2:1638214_at:167:99; Interrogation_Position=764; Antisense; AGATGCGGCACTGTCTGATTGGCCA
>probe:Drosophila_2:1638214_at:140:269; Interrogation_Position=855; Antisense; CATGCCGGCGGGTATTTTTCGACCG
>probe:Drosophila_2:1638214_at:13:703; Interrogation_Position=870; Antisense; TTTTCGACCGCCCATAGAGAGAGAT
>probe:Drosophila_2:1638214_at:498:301; Interrogation_Position=897; Antisense; CCCGGTGGATCTCTGTGGCAACAAA

Paste this into a BLAST search page for me
AGGAGTCACCGCAATTGTTGGCGAAGAAGGTGCATCCGATACGCGCTGATTGATTACAGTGCCATCGACCTGGACTCGACCTGGACATTGATTCCGCCGAAATGCTCTCGTCTGAGGTCCAGTGCAGTGCCTGGCATGCGCGAGCTATTGGTCCGCATCCGTTGATTGTCTTTAATTGTCTTTAATGTTGTCGCTTCGGTGACATTAATGTCCTGGGCACGAAAAGCACTTGAAGATCTACCGCACATTTAGATGCGGCACTGTCTGATTGGCCACATGCCGGCGGGTATTTTTCGACCGTTTTCGACCGCCCATAGAGAGAGATCCCGGTGGATCTCTGTGGCAACAAA

Full Affymetrix probeset data:

Annotations for 1638214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720