FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638215_at:

>probe:Drosophila_2:1638215_at:630:553; Interrogation_Position=1009; Antisense; GGAGCGAAACTTGGACGCGTCTTTG
>probe:Drosophila_2:1638215_at:152:209; Interrogation_Position=1045; Antisense; AAGCATGGTATTGCACTGCTGCGCA
>probe:Drosophila_2:1638215_at:64:145; Interrogation_Position=1059; Antisense; ACTGCTGCGCATCGAGAAGGTTCTC
>probe:Drosophila_2:1638215_at:210:141; Interrogation_Position=1085; Antisense; ACGGCCGTCCTGAGTTGATGATCGA
>probe:Drosophila_2:1638215_at:133:441; Interrogation_Position=1108; Antisense; GATGGCGAGCGCTGTTATGTTGAAC
>probe:Drosophila_2:1638215_at:406:347; Interrogation_Position=1172; Antisense; GCATGGCTTTCGCTGAGTGACTTAC
>probe:Drosophila_2:1638215_at:709:591; Interrogation_Position=697; Antisense; TGGTCCAAGCTGTCCAAATGTTTTG
>probe:Drosophila_2:1638215_at:188:167; Interrogation_Position=712; Antisense; AAATGTTTTGCTGACTTCGGTACCG
>probe:Drosophila_2:1638215_at:345:125; Interrogation_Position=744; Antisense; AGCCTCCTCCGACAATAGTTATCAA
>probe:Drosophila_2:1638215_at:685:677; Interrogation_Position=759; Antisense; TAGTTATCAACTGCTGCGCTACAAG
>probe:Drosophila_2:1638215_at:451:167; Interrogation_Position=823; Antisense; AAATGTTTTCCCCTCGAAGCGAATG
>probe:Drosophila_2:1638215_at:234:543; Interrogation_Position=849; Antisense; GGATTACCTGCATGGCGTGAGCTTC
>probe:Drosophila_2:1638215_at:515:9; Interrogation_Position=920; Antisense; ATTCGGGCGTGATCCGCAAGCGATA
>probe:Drosophila_2:1638215_at:415:439; Interrogation_Position=973; Antisense; GATGTGGGTTCCAGCCAGGACGTAA

Paste this into a BLAST search page for me
GGAGCGAAACTTGGACGCGTCTTTGAAGCATGGTATTGCACTGCTGCGCAACTGCTGCGCATCGAGAAGGTTCTCACGGCCGTCCTGAGTTGATGATCGAGATGGCGAGCGCTGTTATGTTGAACGCATGGCTTTCGCTGAGTGACTTACTGGTCCAAGCTGTCCAAATGTTTTGAAATGTTTTGCTGACTTCGGTACCGAGCCTCCTCCGACAATAGTTATCAATAGTTATCAACTGCTGCGCTACAAGAAATGTTTTCCCCTCGAAGCGAATGGGATTACCTGCATGGCGTGAGCTTCATTCGGGCGTGATCCGCAAGCGATAGATGTGGGTTCCAGCCAGGACGTAA

Full Affymetrix probeset data:

Annotations for 1638215_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720