FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638216_at:

>probe:Drosophila_2:1638216_at:446:685; Interrogation_Position=163; Antisense; TATCGACACCTATCGTTATCGTGCG
>probe:Drosophila_2:1638216_at:505:161; Interrogation_Position=265; Antisense; AAATTATGGCGTTCCTACTGCGACA
>probe:Drosophila_2:1638216_at:407:161; Interrogation_Position=287; Antisense; ACAAGTGGCCAGGAGCGGATTGCAA
>probe:Drosophila_2:1638216_at:118:239; Interrogation_Position=315; Antisense; AATCTAATCCTAATGCGGCATGCAA
>probe:Drosophila_2:1638216_at:611:323; Interrogation_Position=354; Antisense; GCGAATCCCGAACTTAGTGTCCAGG
>probe:Drosophila_2:1638216_at:344:391; Interrogation_Position=395; Antisense; GAAACGGCTCCGTGAGATCTGCGTG
>probe:Drosophila_2:1638216_at:371:39; Interrogation_Position=411; Antisense; ATCTGCGTGGATGGATCTTTCCTGC
>probe:Drosophila_2:1638216_at:712:35; Interrogation_Position=425; Antisense; ATCTTTCCTGCGTGTGACCGTCGAA
>probe:Drosophila_2:1638216_at:263:447; Interrogation_Position=457; Antisense; GATGCTCCGGCTTTCAGTACAAATT
>probe:Drosophila_2:1638216_at:192:55; Interrogation_Position=508; Antisense; ATGACCGACAGTTTGGCGAGGCTGA
>probe:Drosophila_2:1638216_at:465:513; Interrogation_Position=543; Antisense; GTGATCGATACAGTCTCGCTGGAGT
>probe:Drosophila_2:1638216_at:383:261; Interrogation_Position=581; Antisense; CACCGTGGACTACCATAGCGAACTA
>probe:Drosophila_2:1638216_at:528:673; Interrogation_Position=596; Antisense; TAGCGAACTAATACGCGCCGGTTTC
>probe:Drosophila_2:1638216_at:364:337; Interrogation_Position=664; Antisense; GCTCCTCCTTCTCAATCAAATTGTA

Paste this into a BLAST search page for me
TATCGACACCTATCGTTATCGTGCGAAATTATGGCGTTCCTACTGCGACAACAAGTGGCCAGGAGCGGATTGCAAAATCTAATCCTAATGCGGCATGCAAGCGAATCCCGAACTTAGTGTCCAGGGAAACGGCTCCGTGAGATCTGCGTGATCTGCGTGGATGGATCTTTCCTGCATCTTTCCTGCGTGTGACCGTCGAAGATGCTCCGGCTTTCAGTACAAATTATGACCGACAGTTTGGCGAGGCTGAGTGATCGATACAGTCTCGCTGGAGTCACCGTGGACTACCATAGCGAACTATAGCGAACTAATACGCGCCGGTTTCGCTCCTCCTTCTCAATCAAATTGTA

Full Affymetrix probeset data:

Annotations for 1638216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720