FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638217_at:

>probe:Drosophila_2:1638217_at:722:675; Interrogation_Position=170; Antisense; TAGACGTGGCCAAAGACCTGCAGAA
>probe:Drosophila_2:1638217_at:132:415; Interrogation_Position=224; Antisense; GACCACGTGGCTCCAAATTGGGACT
>probe:Drosophila_2:1638217_at:155:233; Interrogation_Position=239; Antisense; AATTGGGACTCGGAACGGCCTACAT
>probe:Drosophila_2:1638217_at:262:49; Interrogation_Position=278; Antisense; ATGCCACCGGCGACTTTATAGTTAT
>probe:Drosophila_2:1638217_at:269:331; Interrogation_Position=310; Antisense; GCGGACTTGAGTCATCATCCCAAAT
>probe:Drosophila_2:1638217_at:616:711; Interrogation_Position=334; Antisense; TTCATTCCCGAGTTCATTAAGCTGC
>probe:Drosophila_2:1638217_at:169:683; Interrogation_Position=373; Antisense; TATGACATTGTATCCGGCACTCGGT
>probe:Drosophila_2:1638217_at:176:645; Interrogation_Position=416; Antisense; TCTTTGGCTGGGACTTCAAGCGCAA
>probe:Drosophila_2:1638217_at:60:599; Interrogation_Position=467; Antisense; TGTCCCAGGTGCTTTTACGTCCGAA
>probe:Drosophila_2:1638217_at:93:167; Interrogation_Position=544; Antisense; AAATGCATTGCCAGCTGCGTGTCCA
>probe:Drosophila_2:1638217_at:159:513; Interrogation_Position=562; Antisense; GTGTCCAAAGGCTACGTGTTCCAAA
>probe:Drosophila_2:1638217_at:409:65; Interrogation_Position=586; Antisense; ATGGAGATGCTCGTTCGGGCTAGAC
>probe:Drosophila_2:1638217_at:179:35; Interrogation_Position=640; Antisense; ATCACCTTCGTGGACCGTATTTATG
>probe:Drosophila_2:1638217_at:12:289; Interrogation_Position=678; Antisense; CGGCGGGACCGAGATTATTCAGTTT

Paste this into a BLAST search page for me
TAGACGTGGCCAAAGACCTGCAGAAGACCACGTGGCTCCAAATTGGGACTAATTGGGACTCGGAACGGCCTACATATGCCACCGGCGACTTTATAGTTATGCGGACTTGAGTCATCATCCCAAATTTCATTCCCGAGTTCATTAAGCTGCTATGACATTGTATCCGGCACTCGGTTCTTTGGCTGGGACTTCAAGCGCAATGTCCCAGGTGCTTTTACGTCCGAAAAATGCATTGCCAGCTGCGTGTCCAGTGTCCAAAGGCTACGTGTTCCAAAATGGAGATGCTCGTTCGGGCTAGACATCACCTTCGTGGACCGTATTTATGCGGCGGGACCGAGATTATTCAGTTT

Full Affymetrix probeset data:

Annotations for 1638217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720