Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638218_at:

>probe:Drosophila_2:1638218_at:604:393; Interrogation_Position=1044; Antisense; GAAATGGTTCTATTGGAGCCCTTTA
>probe:Drosophila_2:1638218_at:214:443; Interrogation_Position=550; Antisense; GATGTGAATTCCGAGTCTGGTCTCC
>probe:Drosophila_2:1638218_at:701:39; Interrogation_Position=674; Antisense; ATCGGTATCCCACATCTCGGATATA
>probe:Drosophila_2:1638218_at:172:115; Interrogation_Position=730; Antisense; AGCAGATTCCTTGGGCTGGTCGTCA
>probe:Drosophila_2:1638218_at:452:129; Interrogation_Position=759; Antisense; ACCATAATGGCCAATCGTCGTTCAA
>probe:Drosophila_2:1638218_at:129:497; Interrogation_Position=775; Antisense; GTCGTTCAAATATCGTACCCATAGT
>probe:Drosophila_2:1638218_at:555:87; Interrogation_Position=797; Antisense; AGTCGAGGATGCTACCATGCCATAT
>probe:Drosophila_2:1638218_at:72:663; Interrogation_Position=821; Antisense; TAAATACCGCTATGAGGTTCCCGCT
>probe:Drosophila_2:1638218_at:425:79; Interrogation_Position=835; Antisense; AGGTTCCCGCTTGCATTGACATTAT
>probe:Drosophila_2:1638218_at:450:723; Interrogation_Position=850; Antisense; TTGACATTATCTTCGCTGATCTTCC
>probe:Drosophila_2:1638218_at:48:541; Interrogation_Position=881; Antisense; GGTTCTGATTCGAGCTCTGATGCTA
>probe:Drosophila_2:1638218_at:88:663; Interrogation_Position=904; Antisense; TAAATGCTAGACACTTCCTGAACCC
>probe:Drosophila_2:1638218_at:346:579; Interrogation_Position=943; Antisense; TGGCCTATTTACATTCGCCTACTAG
>probe:Drosophila_2:1638218_at:183:33; Interrogation_Position=985; Antisense; ATAAGGATTCCTTTGCCGCCGAGAG

Paste this into a BLAST search page for me
GAAATGGTTCTATTGGAGCCCTTTAGATGTGAATTCCGAGTCTGGTCTCCATCGGTATCCCACATCTCGGATATAAGCAGATTCCTTGGGCTGGTCGTCAACCATAATGGCCAATCGTCGTTCAAGTCGTTCAAATATCGTACCCATAGTAGTCGAGGATGCTACCATGCCATATTAAATACCGCTATGAGGTTCCCGCTAGGTTCCCGCTTGCATTGACATTATTTGACATTATCTTCGCTGATCTTCCGGTTCTGATTCGAGCTCTGATGCTATAAATGCTAGACACTTCCTGAACCCTGGCCTATTTACATTCGCCTACTAGATAAGGATTCCTTTGCCGCCGAGAG

Full Affymetrix probeset data:

Annotations for 1638218_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime