Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638220_at:

>probe:Drosophila_2:1638220_at:462:61; Interrogation_Position=13; Antisense; ATGTCCGCTTATAGATTGAGTTGCA
>probe:Drosophila_2:1638220_at:473:169; Interrogation_Position=150; Antisense; AAAGGCGCCTCTCGAATTGCAGCTG
>probe:Drosophila_2:1638220_at:412:237; Interrogation_Position=190; Antisense; AATCGTGCACTCGAGCTGGTCAGGA
>probe:Drosophila_2:1638220_at:62:227; Interrogation_Position=223; Antisense; AAGGCTGCTTTGGAACGGACCGAAT
>probe:Drosophila_2:1638220_at:332:555; Interrogation_Position=239; Antisense; GGACCGAATCCTCGCCAAGAAGTAA
>probe:Drosophila_2:1638220_at:718:295; Interrogation_Position=251; Antisense; CGCCAAGAAGTAAGTGCCGTCCACT
>probe:Drosophila_2:1638220_at:370:635; Interrogation_Position=292; Antisense; TCGCCGCGTACCACGAATCGAATGA
>probe:Drosophila_2:1638220_at:35:379; Interrogation_Position=315; Antisense; GAAGCTGATCATGGAGACTCGCGTG
>probe:Drosophila_2:1638220_at:268:623; Interrogation_Position=338; Antisense; TGCGTCCAGCGATCGTCAAAAAGTC
>probe:Drosophila_2:1638220_at:524:499; Interrogation_Position=366; Antisense; GTCGGAGTACAATCTATGTCCCAGT
>probe:Drosophila_2:1638220_at:118:681; Interrogation_Position=380; Antisense; TATGTCCCAGTTGTGGGCTTGTCAA
>probe:Drosophila_2:1638220_at:282:525; Interrogation_Position=394; Antisense; GGGCTTGTCAAGGACTCGATTCTCA
>probe:Drosophila_2:1638220_at:377:375; Interrogation_Position=444; Antisense; GAAGAAGCTACTGGCACAGCATCCC
>probe:Drosophila_2:1638220_at:301:439; Interrogation_Position=97; Antisense; GAGGCCATCGAACAGTTGCGCGATA

Paste this into a BLAST search page for me
ATGTCCGCTTATAGATTGAGTTGCAAAAGGCGCCTCTCGAATTGCAGCTGAATCGTGCACTCGAGCTGGTCAGGAAAGGCTGCTTTGGAACGGACCGAATGGACCGAATCCTCGCCAAGAAGTAACGCCAAGAAGTAAGTGCCGTCCACTTCGCCGCGTACCACGAATCGAATGAGAAGCTGATCATGGAGACTCGCGTGTGCGTCCAGCGATCGTCAAAAAGTCGTCGGAGTACAATCTATGTCCCAGTTATGTCCCAGTTGTGGGCTTGTCAAGGGCTTGTCAAGGACTCGATTCTCAGAAGAAGCTACTGGCACAGCATCCCGAGGCCATCGAACAGTTGCGCGATA

Full Affymetrix probeset data:

Annotations for 1638220_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime