FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638221_at:

>probe:Drosophila_2:1638221_at:399:689; Interrogation_Position=339; Antisense; TTTGGAAGACCCGTCTACGAAGCCT
>probe:Drosophila_2:1638221_at:622:585; Interrogation_Position=376; Antisense; TGGAACTGCCATTCGAATCAGGCGA
>probe:Drosophila_2:1638221_at:540:419; Interrogation_Position=401; Antisense; GAGCAGCTGCAAACATGCCTACGAG
>probe:Drosophila_2:1638221_at:30:261; Interrogation_Position=456; Antisense; CACCCGTTCACGGTTATTGACAACA
>probe:Drosophila_2:1638221_at:111:613; Interrogation_Position=473; Antisense; TGACAACATGCCAAACATATCCCCG
>probe:Drosophila_2:1638221_at:419:371; Interrogation_Position=515; Antisense; GAAGGACTGCCTTCAGGATGTCCAC
>probe:Drosophila_2:1638221_at:669:559; Interrogation_Position=550; Antisense; GGAAGAGCTTCGATGCCTTCGCCTA
>probe:Drosophila_2:1638221_at:389:719; Interrogation_Position=567; Antisense; TTCGCCTACTATCCTGTCAATGAAC
>probe:Drosophila_2:1638221_at:428:493; Interrogation_Position=582; Antisense; GTCAATGAACCGATTCCGTGCTTCA
>probe:Drosophila_2:1638221_at:535:715; Interrogation_Position=615; Antisense; TTCGTGGACAAGCTGCATATCTTCG
>probe:Drosophila_2:1638221_at:33:387; Interrogation_Position=644; Antisense; GAAAACGCGTCTTTGGAAACTGGAG
>probe:Drosophila_2:1638221_at:239:75; Interrogation_Position=701; Antisense; AGGAGCTCGCATAAGGACCTGCCAT
>probe:Drosophila_2:1638221_at:283:567; Interrogation_Position=735; Antisense; GGCAGGGACCGATGTGCCACATATT
>probe:Drosophila_2:1638221_at:589:177; Interrogation_Position=762; Antisense; AAACAGTTCACCTGCTACGCGATGG

Paste this into a BLAST search page for me
TTTGGAAGACCCGTCTACGAAGCCTTGGAACTGCCATTCGAATCAGGCGAGAGCAGCTGCAAACATGCCTACGAGCACCCGTTCACGGTTATTGACAACATGACAACATGCCAAACATATCCCCGGAAGGACTGCCTTCAGGATGTCCACGGAAGAGCTTCGATGCCTTCGCCTATTCGCCTACTATCCTGTCAATGAACGTCAATGAACCGATTCCGTGCTTCATTCGTGGACAAGCTGCATATCTTCGGAAAACGCGTCTTTGGAAACTGGAGAGGAGCTCGCATAAGGACCTGCCATGGCAGGGACCGATGTGCCACATATTAAACAGTTCACCTGCTACGCGATGG

Full Affymetrix probeset data:

Annotations for 1638221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720