FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638223_at:

>probe:Drosophila_2:1638223_at:681:145; Interrogation_Position=1028; Antisense; ACTATGCATTTCCAGTGTATACCCT
>probe:Drosophila_2:1638223_at:478:473; Interrogation_Position=1044; Antisense; GTATACCCTGGGTAAACTGCTCCAG
>probe:Drosophila_2:1638223_at:64:513; Interrogation_Position=1109; Antisense; GTGATCGCTCGGCAAGAAGCTCCTT
>probe:Drosophila_2:1638223_at:185:527; Interrogation_Position=1139; Antisense; GGGAGCCTAGTACCTGGTTTATACT
>probe:Drosophila_2:1638223_at:394:665; Interrogation_Position=1163; Antisense; TAAATTCACGCTACAAGGGACCCTA
>probe:Drosophila_2:1638223_at:399:555; Interrogation_Position=1180; Antisense; GGACCCTACCATCGGTCACATGGAA
>probe:Drosophila_2:1638223_at:87:107; Interrogation_Position=1244; Antisense; AGAACGGCTTCAGACCTCGGAGATA
>probe:Drosophila_2:1638223_at:310:155; Interrogation_Position=1345; Antisense; ACAGATCACAGTGCTCCGAGATGAT
>probe:Drosophila_2:1638223_at:506:443; Interrogation_Position=1364; Antisense; GATGATCATTAATGCCTCTCTCCAT
>probe:Drosophila_2:1638223_at:227:415; Interrogation_Position=874; Antisense; GAGCCAACAGAAACGTCTACCGCCA
>probe:Drosophila_2:1638223_at:67:511; Interrogation_Position=905; Antisense; GTGAGCCCTTCCAGATCGTCTACAT
>probe:Drosophila_2:1638223_at:143:429; Interrogation_Position=936; Antisense; GAGTTTGGAACGACCAGCCGTCGAT
>probe:Drosophila_2:1638223_at:458:199; Interrogation_Position=984; Antisense; AACGCCATTGCGACAGAGCTCTCGG
>probe:Drosophila_2:1638223_at:165:419; Interrogation_Position=999; Antisense; GAGCTCTCGGTATGCCCTGAAAAAG

Paste this into a BLAST search page for me
ACTATGCATTTCCAGTGTATACCCTGTATACCCTGGGTAAACTGCTCCAGGTGATCGCTCGGCAAGAAGCTCCTTGGGAGCCTAGTACCTGGTTTATACTTAAATTCACGCTACAAGGGACCCTAGGACCCTACCATCGGTCACATGGAAAGAACGGCTTCAGACCTCGGAGATAACAGATCACAGTGCTCCGAGATGATGATGATCATTAATGCCTCTCTCCATGAGCCAACAGAAACGTCTACCGCCAGTGAGCCCTTCCAGATCGTCTACATGAGTTTGGAACGACCAGCCGTCGATAACGCCATTGCGACAGAGCTCTCGGGAGCTCTCGGTATGCCCTGAAAAAG

Full Affymetrix probeset data:

Annotations for 1638223_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720