FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638224_at:

>probe:Drosophila_2:1638224_at:358:201; Interrogation_Position=1011; Antisense; AACCAAGCAGCGTCATCGCAGCAAG
>probe:Drosophila_2:1638224_at:13:215; Interrogation_Position=1033; Antisense; AAGGAGTCGGACTCGAAGCCGTCCA
>probe:Drosophila_2:1638224_at:63:349; Interrogation_Position=1101; Antisense; GATGATCAGCATACTGCAGCACCAG
>probe:Drosophila_2:1638224_at:253:113; Interrogation_Position=1118; Antisense; AGCACCAGGGCATTCGTGGACTGTT
>probe:Drosophila_2:1638224_at:109:407; Interrogation_Position=1136; Antisense; GACTGTTCCGCGGTCTGGAGGCCAA
>probe:Drosophila_2:1638224_at:193:587; Interrogation_Position=1151; Antisense; TGGAGGCCAAGATCCTGCAAACCGT
>probe:Drosophila_2:1638224_at:318:321; Interrogation_Position=1186; Antisense; GCCCTGATGTTCATGGCCTACGAAA
>probe:Drosophila_2:1638224_at:121:729; Interrogation_Position=1226; Antisense; TTGGCATGCTGCTTAAGCGCAACTG
>probe:Drosophila_2:1638224_at:706:23; Interrogation_Position=1329; Antisense; ATAGGATATGGCCAGCACACAGACT
>probe:Drosophila_2:1638224_at:106:633; Interrogation_Position=861; Antisense; TCCCGCGCTGCAGTTCATGATGTAT
>probe:Drosophila_2:1638224_at:221:191; Interrogation_Position=901; Antisense; AACATTATGCGCTTCACCGGCGGTG
>probe:Drosophila_2:1638224_at:407:593; Interrogation_Position=929; Antisense; TGGGCAGTCTGAGTTTCTTCTTTAT
>probe:Drosophila_2:1638224_at:102:703; Interrogation_Position=950; Antisense; TTATTGGTGCCATTGCCAAGGCCTT
>probe:Drosophila_2:1638224_at:705:679; Interrogation_Position=991; Antisense; TATCCGCTGCAGTTGGTCCAAACCA

Paste this into a BLAST search page for me
AACCAAGCAGCGTCATCGCAGCAAGAAGGAGTCGGACTCGAAGCCGTCCAGATGATCAGCATACTGCAGCACCAGAGCACCAGGGCATTCGTGGACTGTTGACTGTTCCGCGGTCTGGAGGCCAATGGAGGCCAAGATCCTGCAAACCGTGCCCTGATGTTCATGGCCTACGAAATTGGCATGCTGCTTAAGCGCAACTGATAGGATATGGCCAGCACACAGACTTCCCGCGCTGCAGTTCATGATGTATAACATTATGCGCTTCACCGGCGGTGTGGGCAGTCTGAGTTTCTTCTTTATTTATTGGTGCCATTGCCAAGGCCTTTATCCGCTGCAGTTGGTCCAAACCA

Full Affymetrix probeset data:

Annotations for 1638224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720