Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638226_at:

>probe:Drosophila_2:1638226_at:136:389; Interrogation_Position=1054; Antisense; GAAATACTCGAAACCCATTCCTAGT
>probe:Drosophila_2:1638226_at:253:201; Interrogation_Position=1065; Antisense; AACCCATTCCTAGTCTGCGAGATAT
>probe:Drosophila_2:1638226_at:284:295; Interrogation_Position=1082; Antisense; CGAGATATTCATTTGGCGCTGTTCA
>probe:Drosophila_2:1638226_at:164:581; Interrogation_Position=1095; Antisense; TGGCGCTGTTCAAATACGGCTACTT
>probe:Drosophila_2:1638226_at:344:241; Interrogation_Position=1107; Antisense; AATACGGCTACTTCGGCTACACGGT
>probe:Drosophila_2:1638226_at:591:535; Interrogation_Position=1129; Antisense; GGTCGCTACTGGTGTAATGTCTGCT
>probe:Drosophila_2:1638226_at:245:231; Interrogation_Position=1144; Antisense; AATGTCTGCTGTTCTTTTGGATCCC
>probe:Drosophila_2:1638226_at:412:589; Interrogation_Position=1161; Antisense; TGGATCCCACGGACAGTGCTAGTTT
>probe:Drosophila_2:1638226_at:478:191; Interrogation_Position=1190; Antisense; AACTTCATAGGTGGCAGTGACTTCC
>probe:Drosophila_2:1638226_at:546:511; Interrogation_Position=1206; Antisense; GTGACTTCCAGATGCAGCTCTACAA
>probe:Drosophila_2:1638226_at:106:647; Interrogation_Position=1263; Antisense; TCATGCCCTGGCTGTTAAATCGTGG
>probe:Drosophila_2:1638226_at:569:165; Interrogation_Position=1279; Antisense; AAATCGTGGCGCCTTGGAGCTCTAG
>probe:Drosophila_2:1638226_at:273:639; Interrogation_Position=1299; Antisense; TCTAGTGCCGCCAACGAAGTGATTT
>probe:Drosophila_2:1638226_at:538:483; Interrogation_Position=1390; Antisense; GTATCTGTGCGCGATAATGGCAACG

Paste this into a BLAST search page for me
GAAATACTCGAAACCCATTCCTAGTAACCCATTCCTAGTCTGCGAGATATCGAGATATTCATTTGGCGCTGTTCATGGCGCTGTTCAAATACGGCTACTTAATACGGCTACTTCGGCTACACGGTGGTCGCTACTGGTGTAATGTCTGCTAATGTCTGCTGTTCTTTTGGATCCCTGGATCCCACGGACAGTGCTAGTTTAACTTCATAGGTGGCAGTGACTTCCGTGACTTCCAGATGCAGCTCTACAATCATGCCCTGGCTGTTAAATCGTGGAAATCGTGGCGCCTTGGAGCTCTAGTCTAGTGCCGCCAACGAAGTGATTTGTATCTGTGCGCGATAATGGCAACG

Full Affymetrix probeset data:

Annotations for 1638226_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime