Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638227_at:

>probe:Drosophila_2:1638227_at:335:381; Interrogation_Position=10046; Antisense; GAACGCTCGGAGTTTGCCTACATCG
>probe:Drosophila_2:1638227_at:311:721; Interrogation_Position=10080; Antisense; TTGCCGGAGCGGTGATCTTTATCAT
>probe:Drosophila_2:1638227_at:47:703; Interrogation_Position=10098; Antisense; TTATCATCATCATTGTCCTGCTCAT
>probe:Drosophila_2:1638227_at:379:647; Interrogation_Position=10119; Antisense; TCATCTGGATGATTTGCGTGCGCTC
>probe:Drosophila_2:1638227_at:293:97; Interrogation_Position=10167; Antisense; AGATGCTAACACCTGCGATTGACCA
>probe:Drosophila_2:1638227_at:3:573; Interrogation_Position=10196; Antisense; GGCTCGCAGGTGAACTTCTACTACG
>probe:Drosophila_2:1638227_at:616:151; Interrogation_Position=10268; Antisense; ACATATGCGCACTACTACGACGACG
>probe:Drosophila_2:1638227_at:319:529; Interrogation_Position=10305; Antisense; GGGAGATGCCCAACTTCTACAATGA
>probe:Drosophila_2:1638227_at:157:445; Interrogation_Position=10363; Antisense; GATGAGCACGTTGGCCAGATCGAAT
>probe:Drosophila_2:1638227_at:704:365; Interrogation_Position=10384; Antisense; GAATGCCTCGCTCTATGGAACTAAA
>probe:Drosophila_2:1638227_at:129:489; Interrogation_Position=10458; Antisense; GTACGATTACCATTGCTACCTTACC
>probe:Drosophila_2:1638227_at:319:339; Interrogation_Position=10472; Antisense; GCTACCTTACCATTGAATCTTCCAT
>probe:Drosophila_2:1638227_at:683:515; Interrogation_Position=9944; Antisense; GTGTGCGATGGCTTCTGCGAGAACT
>probe:Drosophila_2:1638227_at:95:327; Interrogation_Position=9960; Antisense; GCGAGAACTCTGGTGCGTGTGTCAA

Paste this into a BLAST search page for me
GAACGCTCGGAGTTTGCCTACATCGTTGCCGGAGCGGTGATCTTTATCATTTATCATCATCATTGTCCTGCTCATTCATCTGGATGATTTGCGTGCGCTCAGATGCTAACACCTGCGATTGACCAGGCTCGCAGGTGAACTTCTACTACGACATATGCGCACTACTACGACGACGGGGAGATGCCCAACTTCTACAATGAGATGAGCACGTTGGCCAGATCGAATGAATGCCTCGCTCTATGGAACTAAAGTACGATTACCATTGCTACCTTACCGCTACCTTACCATTGAATCTTCCATGTGTGCGATGGCTTCTGCGAGAACTGCGAGAACTCTGGTGCGTGTGTCAA

Full Affymetrix probeset data:

Annotations for 1638227_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime