FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638229_at:

>probe:Drosophila_2:1638229_at:541:563; Interrogation_Position=312; Antisense; GGCGGATCCCGAACGGAAATGCTTT
>probe:Drosophila_2:1638229_at:369:257; Interrogation_Position=340; Antisense; CAAATTGGTGGTGTGCTGTGCGAAA
>probe:Drosophila_2:1638229_at:202:303; Interrogation_Position=368; Antisense; CCGTGAAGGAGGTGCTGCCACAGCT
>probe:Drosophila_2:1638229_at:168:251; Interrogation_Position=402; Antisense; CAAGGATTTCATCGCCAAGACCATC
>probe:Drosophila_2:1638229_at:166:95; Interrogation_Position=497; Antisense; AGATTCGCGGCGAACACTTGGTTGC
>probe:Drosophila_2:1638229_at:431:329; Interrogation_Position=556; Antisense; GCGGAGAACCGTAATGTCCTGGTGT
>probe:Drosophila_2:1638229_at:154:505; Interrogation_Position=571; Antisense; GTCCTGGTGTTCAACTGAGAGCGAT
>probe:Drosophila_2:1638229_at:453:425; Interrogation_Position=587; Antisense; GAGAGCGATTGATTACCTCACCACA
>probe:Drosophila_2:1638229_at:117:673; Interrogation_Position=600; Antisense; TACCTCACCACACCGTATTTATTGT
>probe:Drosophila_2:1638229_at:523:383; Interrogation_Position=640; Antisense; GAACTCTGCCAGGATTTGCGAGCGA
>probe:Drosophila_2:1638229_at:193:723; Interrogation_Position=655; Antisense; TTGCGAGCGATAATCCGCGTTTATT
>probe:Drosophila_2:1638229_at:238:681; Interrogation_Position=697; Antisense; TATGTACTTCTAGCTGTAAGGCGCA
>probe:Drosophila_2:1638229_at:715:683; Interrogation_Position=761; Antisense; TATCCATCAATTCCCCTCATTTAAA
>probe:Drosophila_2:1638229_at:433:133; Interrogation_Position=790; Antisense; ACCCACTCTGGCCACGAATTAAAGA

Paste this into a BLAST search page for me
GGCGGATCCCGAACGGAAATGCTTTCAAATTGGTGGTGTGCTGTGCGAAACCGTGAAGGAGGTGCTGCCACAGCTCAAGGATTTCATCGCCAAGACCATCAGATTCGCGGCGAACACTTGGTTGCGCGGAGAACCGTAATGTCCTGGTGTGTCCTGGTGTTCAACTGAGAGCGATGAGAGCGATTGATTACCTCACCACATACCTCACCACACCGTATTTATTGTGAACTCTGCCAGGATTTGCGAGCGATTGCGAGCGATAATCCGCGTTTATTTATGTACTTCTAGCTGTAAGGCGCATATCCATCAATTCCCCTCATTTAAAACCCACTCTGGCCACGAATTAAAGA

Full Affymetrix probeset data:

Annotations for 1638229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720