Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638230_at:

>probe:Drosophila_2:1638230_at:626:329; Interrogation_Position=2901; Antisense; GCGTGGTTTTACTGTACTGCCAGGC
>probe:Drosophila_2:1638230_at:111:315; Interrogation_Position=2927; Antisense; GCCATCTACAGGCTGACCTATGTGA
>probe:Drosophila_2:1638230_at:457:517; Interrogation_Position=3009; Antisense; GTGTGTCACGAGTCTAGTTTCAGTT
>probe:Drosophila_2:1638230_at:523:335; Interrogation_Position=3066; Antisense; GCTGCGTTAGTTAATGCACTTCGAT
>probe:Drosophila_2:1638230_at:339:101; Interrogation_Position=3096; Antisense; AGAGAGTGTCGCTTATGTAAACCAA
>probe:Drosophila_2:1638230_at:335:97; Interrogation_Position=3145; Antisense; AGATCTGGATCTCCACCAGCGGGAA
>probe:Drosophila_2:1638230_at:471:219; Interrogation_Position=3168; Antisense; AAGTCCAAACTGAGCTCGGCTGGGC
>probe:Drosophila_2:1638230_at:271:321; Interrogation_Position=3207; Antisense; GCCCCGATCGCACGTTATATGTATT
>probe:Drosophila_2:1638230_at:630:711; Interrogation_Position=3230; Antisense; TTAATTGTTTTTACGCCTGCTGTCT
>probe:Drosophila_2:1638230_at:450:599; Interrogation_Position=3250; Antisense; TGTCTGCTGCATTCGATTGGCGATT
>probe:Drosophila_2:1638230_at:350:567; Interrogation_Position=3296; Antisense; GGCACGTAGTTCTCCATTTGAGGGA
>probe:Drosophila_2:1638230_at:110:699; Interrogation_Position=3334; Antisense; TTTAATGCCCATTAGCAGCAGCGAC
>probe:Drosophila_2:1638230_at:266:157; Interrogation_Position=3357; Antisense; ACACTCGCCAGCCATTTTGTGGTTT
>probe:Drosophila_2:1638230_at:51:89; Interrogation_Position=3405; Antisense; AGATCTTAGTACTTTAGTCCCTCCG

Paste this into a BLAST search page for me
GCGTGGTTTTACTGTACTGCCAGGCGCCATCTACAGGCTGACCTATGTGAGTGTGTCACGAGTCTAGTTTCAGTTGCTGCGTTAGTTAATGCACTTCGATAGAGAGTGTCGCTTATGTAAACCAAAGATCTGGATCTCCACCAGCGGGAAAAGTCCAAACTGAGCTCGGCTGGGCGCCCCGATCGCACGTTATATGTATTTTAATTGTTTTTACGCCTGCTGTCTTGTCTGCTGCATTCGATTGGCGATTGGCACGTAGTTCTCCATTTGAGGGATTTAATGCCCATTAGCAGCAGCGACACACTCGCCAGCCATTTTGTGGTTTAGATCTTAGTACTTTAGTCCCTCCG

Full Affymetrix probeset data:

Annotations for 1638230_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime