Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638231_at:

>probe:Drosophila_2:1638231_at:55:341; Interrogation_Position=3487; Antisense; GCTAGAAAGACAGCCGCTCTGCAAA
>probe:Drosophila_2:1638231_at:458:187; Interrogation_Position=3550; Antisense; AATCTTAGGACCACCGAATGGCGCC
>probe:Drosophila_2:1638231_at:106:577; Interrogation_Position=3579; Antisense; GGCGCAGACTTTGCTCAACGAGCAC
>probe:Drosophila_2:1638231_at:687:229; Interrogation_Position=3620; Antisense; AATACCTCGGCTCAACGGTTGTGAA
>probe:Drosophila_2:1638231_at:153:357; Interrogation_Position=3656; Antisense; GCACAGAGTCCACCAAGAAGTCCAT
>probe:Drosophila_2:1638231_at:54:333; Interrogation_Position=3735; Antisense; GCTGGCAATTTGTCACCGTGGCGTA
>probe:Drosophila_2:1638231_at:505:107; Interrogation_Position=3809; Antisense; AGAACATCAATTGCGCCTGCCAGGA
>probe:Drosophila_2:1638231_at:562:635; Interrogation_Position=3835; Antisense; TCGGAGGACTTGAGGCACTTTGCCT
>probe:Drosophila_2:1638231_at:152:79; Interrogation_Position=3875; Antisense; AGGATCTGCACTACTGCCACGTTTT
>probe:Drosophila_2:1638231_at:453:627; Interrogation_Position=3889; Antisense; TGCCACGTTTTCCTGGTCGAAAGCA
>probe:Drosophila_2:1638231_at:23:647; Interrogation_Position=3932; Antisense; TCATTCTGACACTGGGACAGGCCTT
>probe:Drosophila_2:1638231_at:249:717; Interrogation_Position=3955; Antisense; TTCGAGGTGGCCTATCAACTGGCAC
>probe:Drosophila_2:1638231_at:371:253; Interrogation_Position=3970; Antisense; CAACTGGCACTACGCGATGGAATCA
>probe:Drosophila_2:1638231_at:275:441; Interrogation_Position=3985; Antisense; GATGGAATCACGACCACGCCAGAAC

Paste this into a BLAST search page for me
GCTAGAAAGACAGCCGCTCTGCAAAAATCTTAGGACCACCGAATGGCGCCGGCGCAGACTTTGCTCAACGAGCACAATACCTCGGCTCAACGGTTGTGAAGCACAGAGTCCACCAAGAAGTCCATGCTGGCAATTTGTCACCGTGGCGTAAGAACATCAATTGCGCCTGCCAGGATCGGAGGACTTGAGGCACTTTGCCTAGGATCTGCACTACTGCCACGTTTTTGCCACGTTTTCCTGGTCGAAAGCATCATTCTGACACTGGGACAGGCCTTTTCGAGGTGGCCTATCAACTGGCACCAACTGGCACTACGCGATGGAATCAGATGGAATCACGACCACGCCAGAAC

Full Affymetrix probeset data:

Annotations for 1638231_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime