FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638233_at:

>probe:Drosophila_2:1638233_at:198:405; Interrogation_Position=111; Antisense; GACTACTCCTTCTTCTTGAAGCTGA
>probe:Drosophila_2:1638233_at:338:585; Interrogation_Position=168; Antisense; TGGCACGATATCACGGAATCCGAAC
>probe:Drosophila_2:1638233_at:33:199; Interrogation_Position=190; Antisense; AACGTGTGCAACAGGATTCGCGCAA
>probe:Drosophila_2:1638233_at:218:579; Interrogation_Position=218; Antisense; GGCCGGCTTTAACTTCTTCATGAAG
>probe:Drosophila_2:1638233_at:461:317; Interrogation_Position=256; Antisense; GCCGGGAGAACAGCATCGACATCGT
>probe:Drosophila_2:1638233_at:107:501; Interrogation_Position=279; Antisense; GTCGACAAGTCGAATGCTCCCTACA
>probe:Drosophila_2:1638233_at:698:141; Interrogation_Position=303; Antisense; ACGGCGGACGATTCTGGCGCATTTA
>probe:Drosophila_2:1638233_at:633:327; Interrogation_Position=394; Antisense; GCGTCTCATCCGCTGAAAATGGCCA
>probe:Drosophila_2:1638233_at:306:387; Interrogation_Position=473; Antisense; GAACAACAACTCTGTGGGCATTTAT
>probe:Drosophila_2:1638233_at:219:11; Interrogation_Position=500; Antisense; ATTCGCCTCGAAGTTCATTAAGCTG
>probe:Drosophila_2:1638233_at:703:365; Interrogation_Position=532; Antisense; GAATCCTGCTGCACTTTACCTAGGA
>probe:Drosophila_2:1638233_at:225:31; Interrogation_Position=589; Antisense; ATAAATGTACACTACACGGCACCCG
>probe:Drosophila_2:1638233_at:687:95; Interrogation_Position=61; Antisense; AGATTTCCGCCACGCTGGAGAACGT
>probe:Drosophila_2:1638233_at:1:161; Interrogation_Position=88; Antisense; ACAAGCTGGAGACGTCTCATCCGGA

Paste this into a BLAST search page for me
GACTACTCCTTCTTCTTGAAGCTGATGGCACGATATCACGGAATCCGAACAACGTGTGCAACAGGATTCGCGCAAGGCCGGCTTTAACTTCTTCATGAAGGCCGGGAGAACAGCATCGACATCGTGTCGACAAGTCGAATGCTCCCTACAACGGCGGACGATTCTGGCGCATTTAGCGTCTCATCCGCTGAAAATGGCCAGAACAACAACTCTGTGGGCATTTATATTCGCCTCGAAGTTCATTAAGCTGGAATCCTGCTGCACTTTACCTAGGAATAAATGTACACTACACGGCACCCGAGATTTCCGCCACGCTGGAGAACGTACAAGCTGGAGACGTCTCATCCGGA

Full Affymetrix probeset data:

Annotations for 1638233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720