Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638235_at:

>probe:Drosophila_2:1638235_at:301:631; Interrogation_Position=116; Antisense; TCCTGATCCCCGAGAGATTGTGAAT
>probe:Drosophila_2:1638235_at:516:463; Interrogation_Position=131; Antisense; GATTGTGAATCTGCAGCCTGAACCA
>probe:Drosophila_2:1638235_at:541:613; Interrogation_Position=149; Antisense; TGAACCACTGGCATATGCTCCCAAT
>probe:Drosophila_2:1638235_at:197:683; Interrogation_Position=162; Antisense; TATGCTCCCAATTTTGATGTGCCCC
>probe:Drosophila_2:1638235_at:135:87; Interrogation_Position=194; Antisense; AGTGCGTCGCCAGTTCCAATTGAAT
>probe:Drosophila_2:1638235_at:662:223; Interrogation_Position=244; Antisense; AAGGATTCGATCTGAGCCTCAACGG
>probe:Drosophila_2:1638235_at:435:197; Interrogation_Position=264; Antisense; AACGGACGTGCTCCCGTTTGGCAGA
>probe:Drosophila_2:1638235_at:184:43; Interrogation_Position=323; Antisense; ATCGTATGCCCAGCACCTTGGTGGA
>probe:Drosophila_2:1638235_at:421:713; Interrogation_Position=340; Antisense; TTGGTGGACCCTATGGCAACAGCCG
>probe:Drosophila_2:1638235_at:103:553; Interrogation_Position=375; Antisense; GGAGCCGGTGGAGTGTATACCTTCA
>probe:Drosophila_2:1638235_at:192:671; Interrogation_Position=392; Antisense; TACCTTCAGGTTTTAGGGCACTTCA
>probe:Drosophila_2:1638235_at:152:653; Interrogation_Position=40; Antisense; TCAAAATGCATTTCACCGCTAGTCT
>probe:Drosophila_2:1638235_at:165:261; Interrogation_Position=53; Antisense; CACCGCTAGTCTTCTATTCATTGGA
>probe:Drosophila_2:1638235_at:455:687; Interrogation_Position=67; Antisense; TATTCATTGGACTGGCTTGTGCCTT

Paste this into a BLAST search page for me
TCCTGATCCCCGAGAGATTGTGAATGATTGTGAATCTGCAGCCTGAACCATGAACCACTGGCATATGCTCCCAATTATGCTCCCAATTTTGATGTGCCCCAGTGCGTCGCCAGTTCCAATTGAATAAGGATTCGATCTGAGCCTCAACGGAACGGACGTGCTCCCGTTTGGCAGAATCGTATGCCCAGCACCTTGGTGGATTGGTGGACCCTATGGCAACAGCCGGGAGCCGGTGGAGTGTATACCTTCATACCTTCAGGTTTTAGGGCACTTCATCAAAATGCATTTCACCGCTAGTCTCACCGCTAGTCTTCTATTCATTGGATATTCATTGGACTGGCTTGTGCCTT

Full Affymetrix probeset data:

Annotations for 1638235_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime