Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638236_at:

>probe:Drosophila_2:1638236_at:337:611; Interrogation_Position=1407; Antisense; TGACGACAACTTCAGTTCGACGCTG
>probe:Drosophila_2:1638236_at:305:175; Interrogation_Position=1495; Antisense; AAACCGGAGTTTACAGCGGCTGCCA
>probe:Drosophila_2:1638236_at:270:573; Interrogation_Position=1512; Antisense; GGCTGCCACGGCCTTACAGGATGAT
>probe:Drosophila_2:1638236_at:50:59; Interrogation_Position=1532; Antisense; ATGATCCTCGGATAGCGTTTGTCGC
>probe:Drosophila_2:1638236_at:366:481; Interrogation_Position=1548; Antisense; GTTTGTCGCCATCGACTGCACAAAG
>probe:Drosophila_2:1638236_at:569:217; Interrogation_Position=1591; Antisense; AAGTATAACGTACGCGGATATCCCA
>probe:Drosophila_2:1638236_at:127:3; Interrogation_Position=1618; Antisense; ATTCTGTACTTCTCTTACCTCAAAA
>probe:Drosophila_2:1638236_at:376:331; Interrogation_Position=1647; Antisense; GCTGGATTACAATGGCGGACGCACC
>probe:Drosophila_2:1638236_at:455:331; Interrogation_Position=1661; Antisense; GCGGACGCACCAGCAAGGACTTTAT
>probe:Drosophila_2:1638236_at:674:701; Interrogation_Position=1682; Antisense; TTATCGCCTATATGAACAACCCGCC
>probe:Drosophila_2:1638236_at:597:217; Interrogation_Position=1747; Antisense; AAGTATAACGATGCTTCTCCCACAA
>probe:Drosophila_2:1638236_at:317:257; Interrogation_Position=1767; Antisense; CACAACACTTTGCAATCTCACTTTT
>probe:Drosophila_2:1638236_at:152:481; Interrogation_Position=1808; Antisense; GTATTCGTTCCGTTCAGTTTACAAT
>probe:Drosophila_2:1638236_at:486:17; Interrogation_Position=1933; Antisense; ATTTCATTTTTACTGCGCTTATCCC

Paste this into a BLAST search page for me
TGACGACAACTTCAGTTCGACGCTGAAACCGGAGTTTACAGCGGCTGCCAGGCTGCCACGGCCTTACAGGATGATATGATCCTCGGATAGCGTTTGTCGCGTTTGTCGCCATCGACTGCACAAAGAAGTATAACGTACGCGGATATCCCAATTCTGTACTTCTCTTACCTCAAAAGCTGGATTACAATGGCGGACGCACCGCGGACGCACCAGCAAGGACTTTATTTATCGCCTATATGAACAACCCGCCAAGTATAACGATGCTTCTCCCACAACACAACACTTTGCAATCTCACTTTTGTATTCGTTCCGTTCAGTTTACAATATTTCATTTTTACTGCGCTTATCCC

Full Affymetrix probeset data:

Annotations for 1638236_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime