FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638237_at:

>probe:Drosophila_2:1638237_at:482:693; Interrogation_Position=518; Antisense; TTTCCAGGGACTGCTAGGCTTCTCA
>probe:Drosophila_2:1638237_at:456:81; Interrogation_Position=544; Antisense; AGGGCGCCTGTTTCGTGGGTCTTAT
>probe:Drosophila_2:1638237_at:356:593; Interrogation_Position=559; Antisense; TGGGTCTTATATGCGGCCTGGCCAA
>probe:Drosophila_2:1638237_at:96:173; Interrogation_Position=584; Antisense; AAAGAAGTTGACCTCCATCCGTCCG
>probe:Drosophila_2:1638237_at:383:47; Interrogation_Position=600; Antisense; ATCCGTCCGGAGTTTGCTGTGCTAG
>probe:Drosophila_2:1638237_at:598:713; Interrogation_Position=633; Antisense; TTCTTGTCTGGCAGTCTGGTGCACA
>probe:Drosophila_2:1638237_at:576:591; Interrogation_Position=649; Antisense; TGGTGCACATGAGCGCCTACGAAGA
>probe:Drosophila_2:1638237_at:234:469; Interrogation_Position=692; Antisense; GTTGCACATCTACGGACAGACGGAT
>probe:Drosophila_2:1638237_at:222:623; Interrogation_Position=752; Antisense; TGCGCGCTTCAAGAACGCCGAGGTG
>probe:Drosophila_2:1638237_at:168:623; Interrogation_Position=775; Antisense; TGCTGGAGCACAGCGGCGGACACTA
>probe:Drosophila_2:1638237_at:390:105; Interrogation_Position=826; Antisense; AGACATTCATCAACTTCTTCCAGGA
>probe:Drosophila_2:1638237_at:137:721; Interrogation_Position=843; Antisense; TTCCAGGATCGGCTGCAGGAGTACC
>probe:Drosophila_2:1638237_at:191:95; Interrogation_Position=880; Antisense; AGTTGCAGCAGAGCGGCAATGCCTC
>probe:Drosophila_2:1638237_at:578:361; Interrogation_Position=895; Antisense; GCAATGCCTCATTCGTGGATAGCGG

Paste this into a BLAST search page for me
TTTCCAGGGACTGCTAGGCTTCTCAAGGGCGCCTGTTTCGTGGGTCTTATTGGGTCTTATATGCGGCCTGGCCAAAAAGAAGTTGACCTCCATCCGTCCGATCCGTCCGGAGTTTGCTGTGCTAGTTCTTGTCTGGCAGTCTGGTGCACATGGTGCACATGAGCGCCTACGAAGAGTTGCACATCTACGGACAGACGGATTGCGCGCTTCAAGAACGCCGAGGTGTGCTGGAGCACAGCGGCGGACACTAAGACATTCATCAACTTCTTCCAGGATTCCAGGATCGGCTGCAGGAGTACCAGTTGCAGCAGAGCGGCAATGCCTCGCAATGCCTCATTCGTGGATAGCGG

Full Affymetrix probeset data:

Annotations for 1638237_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720