FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638238_at:

>probe:Drosophila_2:1638238_at:103:701; Interrogation_Position=121; Antisense; TTTTTGCACTGGCTCTAACGGAGGC
>probe:Drosophila_2:1638238_at:714:195; Interrogation_Position=137; Antisense; AACGGAGGCGGCTGTTTACATCGGT
>probe:Drosophila_2:1638238_at:426:601; Interrogation_Position=149; Antisense; TGTTTACATCGGTGGCGGTTGCTAC
>probe:Drosophila_2:1638238_at:386:573; Interrogation_Position=162; Antisense; GGCGGTTGCTACGACTGTAATCCAC
>probe:Drosophila_2:1638238_at:726:437; Interrogation_Position=190; Antisense; GAGGCCAAGGACCTGGAGTCTACAC
>probe:Drosophila_2:1638238_at:131:283; Interrogation_Position=309; Antisense; CGTCGTCCAGTATATTCGGGCAACT
>probe:Drosophila_2:1638238_at:105:563; Interrogation_Position=327; Antisense; GGCAACTTTGGACCCGGCTATGGTA
>probe:Drosophila_2:1638238_at:389:571; Interrogation_Position=398; Antisense; TGGCTACGATGATGGCGGTCTTACG
>probe:Drosophila_2:1638238_at:306:537; Interrogation_Position=414; Antisense; GGTCTTACGCAGATTATAAGCGGCT
>probe:Drosophila_2:1638238_at:2:239; Interrogation_Position=447; Antisense; AATCTCGAAGCTTTGCTAGCGCTAA
>probe:Drosophila_2:1638238_at:596:375; Interrogation_Position=476; Antisense; GAAGAGCAAGCATCGTCTGAAACTT
>probe:Drosophila_2:1638238_at:85:35; Interrogation_Position=538; Antisense; ATCAGCGGTGACTACTTTTATATAC
>probe:Drosophila_2:1638238_at:167:677; Interrogation_Position=74; Antisense; TAGACCAGCCACAATGAGAACCTTG
>probe:Drosophila_2:1638238_at:426:379; Interrogation_Position=91; Antisense; GAACCTTGACGGCATTTGCGATTAT

Paste this into a BLAST search page for me
TTTTTGCACTGGCTCTAACGGAGGCAACGGAGGCGGCTGTTTACATCGGTTGTTTACATCGGTGGCGGTTGCTACGGCGGTTGCTACGACTGTAATCCACGAGGCCAAGGACCTGGAGTCTACACCGTCGTCCAGTATATTCGGGCAACTGGCAACTTTGGACCCGGCTATGGTATGGCTACGATGATGGCGGTCTTACGGGTCTTACGCAGATTATAAGCGGCTAATCTCGAAGCTTTGCTAGCGCTAAGAAGAGCAAGCATCGTCTGAAACTTATCAGCGGTGACTACTTTTATATACTAGACCAGCCACAATGAGAACCTTGGAACCTTGACGGCATTTGCGATTAT

Full Affymetrix probeset data:

Annotations for 1638238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720