FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638243_at:

>probe:Drosophila_2:1638243_at:356:67; Interrogation_Position=107; Antisense; ATGGACAATCGCAGCAGGCAGTGAC
>probe:Drosophila_2:1638243_at:87:269; Interrogation_Position=121; Antisense; CAGGCAGTGACCAACAGCAAGCAGT
>probe:Drosophila_2:1638243_at:523:67; Interrogation_Position=13; Antisense; ATGGAATCCAGCTTCACAGTCTCAC
>probe:Drosophila_2:1638243_at:473:359; Interrogation_Position=137; Antisense; GCAAGCAGTCGCATTTCTGGCTAGA
>probe:Drosophila_2:1638243_at:235:19; Interrogation_Position=149; Antisense; ATTTCTGGCTAGATTGCTCCTGCCT
>probe:Drosophila_2:1638243_at:405:625; Interrogation_Position=169; Antisense; TGCCTTCACTTGTCCGAGCGGAATG
>probe:Drosophila_2:1638243_at:544:727; Interrogation_Position=211; Antisense; TTGGCCATTAATGCCAGCCATTCGC
>probe:Drosophila_2:1638243_at:712:261; Interrogation_Position=225; Antisense; CAGCCATTCGCTGGGAGCCAAGAAC
>probe:Drosophila_2:1638243_at:391:415; Interrogation_Position=239; Antisense; GAGCCAAGAACAACTGCCTGATGAT
>probe:Drosophila_2:1638243_at:631:443; Interrogation_Position=258; Antisense; GATGATCTTCATCGCCGGAATGGAC
>probe:Drosophila_2:1638243_at:496:579; Interrogation_Position=293; Antisense; TGGCCTTTCAGCTCGAGCAGTTGCA
>probe:Drosophila_2:1638243_at:405:345; Interrogation_Position=61; Antisense; GCATCCTTGGCTCTGGGATTAACCG
>probe:Drosophila_2:1638243_at:662:541; Interrogation_Position=76; Antisense; GGATTAACCGTGGTCCTGCTGGCCA
>probe:Drosophila_2:1638243_at:413:621; Interrogation_Position=92; Antisense; TGCTGGCCACCGGAAATGGACAATC

Paste this into a BLAST search page for me
ATGGACAATCGCAGCAGGCAGTGACCAGGCAGTGACCAACAGCAAGCAGTATGGAATCCAGCTTCACAGTCTCACGCAAGCAGTCGCATTTCTGGCTAGAATTTCTGGCTAGATTGCTCCTGCCTTGCCTTCACTTGTCCGAGCGGAATGTTGGCCATTAATGCCAGCCATTCGCCAGCCATTCGCTGGGAGCCAAGAACGAGCCAAGAACAACTGCCTGATGATGATGATCTTCATCGCCGGAATGGACTGGCCTTTCAGCTCGAGCAGTTGCAGCATCCTTGGCTCTGGGATTAACCGGGATTAACCGTGGTCCTGCTGGCCATGCTGGCCACCGGAAATGGACAATC

Full Affymetrix probeset data:

Annotations for 1638243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720