FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638245_at:

>probe:Drosophila_2:1638245_at:198:311; Interrogation_Position=401; Antisense; CCAAGAGCTGTCACCAACTGCGTAG
>probe:Drosophila_2:1638245_at:111:195; Interrogation_Position=416; Antisense; AACTGCGTAGCCTGAGCGTGTCAAG
>probe:Drosophila_2:1638245_at:136:515; Interrogation_Position=433; Antisense; GTGTCAAGTGCGTACATCACGGGAA
>probe:Drosophila_2:1638245_at:152:137; Interrogation_Position=451; Antisense; ACGGGAAAGTACCTCACTGGACTCT
>probe:Drosophila_2:1638245_at:266:321; Interrogation_Position=519; Antisense; GCCCCATCTCTCAGAATTGCTGGAT
>probe:Drosophila_2:1638245_at:721:663; Interrogation_Position=554; Antisense; TAAAGCACCTGGACCTAACCTCAAA
>probe:Drosophila_2:1638245_at:520:235; Interrogation_Position=577; Antisense; AATCGGTATCCCGTGGAGGCGACCA
>probe:Drosophila_2:1638245_at:591:325; Interrogation_Position=633; Antisense; GCGACTTGGCCTATCTGATGCAGAA
>probe:Drosophila_2:1638245_at:13:447; Interrogation_Position=649; Antisense; GATGCAGAAGACTTCGGCTTCCCAC
>probe:Drosophila_2:1638245_at:555:625; Interrogation_Position=686; Antisense; TGCCTCAACTAAACACGCTGGTGGT
>probe:Drosophila_2:1638245_at:121:327; Interrogation_Position=777; Antisense; GCGAGCCGCGAGAAAATATCCCCAG
>probe:Drosophila_2:1638245_at:624:123; Interrogation_Position=800; Antisense; AGCGCCTGCATTCGATCTTAGGCAA
>probe:Drosophila_2:1638245_at:330:373; Interrogation_Position=838; Antisense; GAAGTGGCCCTCGAGCAGATTGCTG
>probe:Drosophila_2:1638245_at:326:515; Interrogation_Position=919; Antisense; GTGTACTTCTTGTCGGATCCGCAGG

Paste this into a BLAST search page for me
CCAAGAGCTGTCACCAACTGCGTAGAACTGCGTAGCCTGAGCGTGTCAAGGTGTCAAGTGCGTACATCACGGGAAACGGGAAAGTACCTCACTGGACTCTGCCCCATCTCTCAGAATTGCTGGATTAAAGCACCTGGACCTAACCTCAAAAATCGGTATCCCGTGGAGGCGACCAGCGACTTGGCCTATCTGATGCAGAAGATGCAGAAGACTTCGGCTTCCCACTGCCTCAACTAAACACGCTGGTGGTGCGAGCCGCGAGAAAATATCCCCAGAGCGCCTGCATTCGATCTTAGGCAAGAAGTGGCCCTCGAGCAGATTGCTGGTGTACTTCTTGTCGGATCCGCAGG

Full Affymetrix probeset data:

Annotations for 1638245_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720