FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638246_at:

>probe:Drosophila_2:1638246_at:486:131; Interrogation_Position=106; Antisense; ACCTGGAGTTCTATGGCCTGTACAA
>probe:Drosophila_2:1638246_at:220:279; Interrogation_Position=116; Antisense; CTATGGCCTGTACAAGCAGTTCCAG
>probe:Drosophila_2:1638246_at:145:629; Interrogation_Position=136; Antisense; TCCAGGAGGGCGACATTAACATCGA
>probe:Drosophila_2:1638246_at:375:595; Interrogation_Position=170; Antisense; TGATGCCGAGGGTGCCGCTAAGTAC
>probe:Drosophila_2:1638246_at:534:199; Interrogation_Position=184; Antisense; CCGCTAAGTACGATGCCTGGCTGAG
>probe:Drosophila_2:1638246_at:67:83; Interrogation_Position=214; Antisense; AGGGACTGTCCGTCGATGACGCCAA
>probe:Drosophila_2:1638246_at:572:277; Interrogation_Position=245; Antisense; CTACGTCGCCCTGTACGAGAAGTAC
>probe:Drosophila_2:1638246_at:122:219; Interrogation_Position=264; Antisense; AAGTACAACCCCATCTACGGATAAG
>probe:Drosophila_2:1638246_at:139:659; Interrogation_Position=285; Antisense; TAAGCTACAGTTTATGGCCCACTCT
>probe:Drosophila_2:1638246_at:9:323; Interrogation_Position=301; Antisense; GCCCACTCTGATACCAACCAATAAA
>probe:Drosophila_2:1638246_at:701:663; Interrogation_Position=322; Antisense; TAAATCTTGACCATCTGTGAACTAA
>probe:Drosophila_2:1638246_at:77:363; Interrogation_Position=34; Antisense; GCAATATGGCCGATTTCAACGCTAT
>probe:Drosophila_2:1638246_at:388:649; Interrogation_Position=49; Antisense; TCAACGCTATCCTCGAGAAGACCAA
>probe:Drosophila_2:1638246_at:213:309; Interrogation_Position=93; Antisense; CCAACGGAGGTGTACCTGGAGTTCT

Paste this into a BLAST search page for me
ACCTGGAGTTCTATGGCCTGTACAACTATGGCCTGTACAAGCAGTTCCAGTCCAGGAGGGCGACATTAACATCGATGATGCCGAGGGTGCCGCTAAGTACCCGCTAAGTACGATGCCTGGCTGAGAGGGACTGTCCGTCGATGACGCCAACTACGTCGCCCTGTACGAGAAGTACAAGTACAACCCCATCTACGGATAAGTAAGCTACAGTTTATGGCCCACTCTGCCCACTCTGATACCAACCAATAAATAAATCTTGACCATCTGTGAACTAAGCAATATGGCCGATTTCAACGCTATTCAACGCTATCCTCGAGAAGACCAACCAACGGAGGTGTACCTGGAGTTCT

Full Affymetrix probeset data:

Annotations for 1638246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720