Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638247_at:

>probe:Drosophila_2:1638247_at:540:605; Interrogation_Position=1005; Antisense; TGATCCTGGTGACGGACGCCATATC
>probe:Drosophila_2:1638247_at:224:399; Interrogation_Position=1065; Antisense; GACAGCTGCCGCTGCAGGTTAAGCA
>probe:Drosophila_2:1638247_at:200:659; Interrogation_Position=1084; Antisense; TAAGCAGGGCAAGGCGTTCATCGCA
>probe:Drosophila_2:1638247_at:251:713; Interrogation_Position=1100; Antisense; TTCATCGCAGGCACAGAGACGCTGT
>probe:Drosophila_2:1638247_at:470:65; Interrogation_Position=1142; Antisense; ATGGACGAGTGCGTGCGGATCTTCC
>probe:Drosophila_2:1638247_at:479:543; Interrogation_Position=1158; Antisense; GGATCTTCCAGAAGGCGACCGACTG
>probe:Drosophila_2:1638247_at:58:621; Interrogation_Position=1181; Antisense; TGCTCCGTGGTCTATGCCATCGAGG
>probe:Drosophila_2:1638247_at:275:723; Interrogation_Position=1214; Antisense; TTGCATCCAGCACAGTGCCTGAAGA
>probe:Drosophila_2:1638247_at:56:403; Interrogation_Position=1262; Antisense; GACTTTGGCTCGGACGCGGACTTCG
>probe:Drosophila_2:1638247_at:160:587; Interrogation_Position=1293; Antisense; TGGACGACCAGCTCCGGGTGCTATC
>probe:Drosophila_2:1638247_at:275:545; Interrogation_Position=1323; Antisense; GGATCGCTGGCGTATGTGTTCATAG
>probe:Drosophila_2:1638247_at:640:73; Interrogation_Position=1346; Antisense; AGGACTGTCAAGTAGCGCATCGAAT
>probe:Drosophila_2:1638247_at:435:349; Interrogation_Position=1405; Antisense; GCAGGATGCAGGATTCTACACCGAA
>probe:Drosophila_2:1638247_at:132:275; Interrogation_Position=1476; Antisense; CTTGAGATTCTTGTGAGTGCAGCCA

Paste this into a BLAST search page for me
TGATCCTGGTGACGGACGCCATATCGACAGCTGCCGCTGCAGGTTAAGCATAAGCAGGGCAAGGCGTTCATCGCATTCATCGCAGGCACAGAGACGCTGTATGGACGAGTGCGTGCGGATCTTCCGGATCTTCCAGAAGGCGACCGACTGTGCTCCGTGGTCTATGCCATCGAGGTTGCATCCAGCACAGTGCCTGAAGAGACTTTGGCTCGGACGCGGACTTCGTGGACGACCAGCTCCGGGTGCTATCGGATCGCTGGCGTATGTGTTCATAGAGGACTGTCAAGTAGCGCATCGAATGCAGGATGCAGGATTCTACACCGAACTTGAGATTCTTGTGAGTGCAGCCA

Full Affymetrix probeset data:

Annotations for 1638247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime