Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638248_at:

>probe:Drosophila_2:1638248_at:299:435; Interrogation_Position=2250; Antisense; GAGGTCGAGATCCATGCTGTCTCTC
>probe:Drosophila_2:1638248_at:317:629; Interrogation_Position=2260; Antisense; TCCATGCTGTCTCTCTATACAAACA
>probe:Drosophila_2:1638248_at:574:185; Interrogation_Position=2281; Antisense; AACAATCCAATCGAGTTTCGTAATG
>probe:Drosophila_2:1638248_at:617:61; Interrogation_Position=2310; Antisense; ATGTGACATCTGTCGTGAAATGTTA
>probe:Drosophila_2:1638248_at:723:347; Interrogation_Position=2340; Antisense; GCAGTCCATTTATTTTCTTTGTCAA
>probe:Drosophila_2:1638248_at:518:275; Interrogation_Position=2356; Antisense; CTTTGTCAACATTCCTTTCATGAAG
>probe:Drosophila_2:1638248_at:199:369; Interrogation_Position=2380; Antisense; GAATGCCTCAATTACAAATCGACCA
>probe:Drosophila_2:1638248_at:156:475; Interrogation_Position=2451; Antisense; GTTAAGTCCAAAACATTCTTCCAAT
>probe:Drosophila_2:1638248_at:140:713; Interrogation_Position=2466; Antisense; TTCTTCCAATTTTTCCTGTGATTCT
>probe:Drosophila_2:1638248_at:678:513; Interrogation_Position=2483; Antisense; GTGATTCTTCAGATACTATTGCAGT
>probe:Drosophila_2:1638248_at:42:327; Interrogation_Position=2576; Antisense; GCGATGGCGTTACTTGTAACCCTTT
>probe:Drosophila_2:1638248_at:169:637; Interrogation_Position=2718; Antisense; TCGATACATTATATGGCACTGCCAA
>probe:Drosophila_2:1638248_at:188:283; Interrogation_Position=2736; Antisense; CTGCCAAGCCACCAATTTTCTATTT
>probe:Drosophila_2:1638248_at:608:167; Interrogation_Position=2762; Antisense; AAATGTGAGGTCTTTCTTAGAAATT

Paste this into a BLAST search page for me
GAGGTCGAGATCCATGCTGTCTCTCTCCATGCTGTCTCTCTATACAAACAAACAATCCAATCGAGTTTCGTAATGATGTGACATCTGTCGTGAAATGTTAGCAGTCCATTTATTTTCTTTGTCAACTTTGTCAACATTCCTTTCATGAAGGAATGCCTCAATTACAAATCGACCAGTTAAGTCCAAAACATTCTTCCAATTTCTTCCAATTTTTCCTGTGATTCTGTGATTCTTCAGATACTATTGCAGTGCGATGGCGTTACTTGTAACCCTTTTCGATACATTATATGGCACTGCCAACTGCCAAGCCACCAATTTTCTATTTAAATGTGAGGTCTTTCTTAGAAATT

Full Affymetrix probeset data:

Annotations for 1638248_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime