FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638251_at:

>probe:Drosophila_2:1638251_at:69:197; Interrogation_Position=3027; Antisense; AACGGCCACATTATCTACTTGCAAG
>probe:Drosophila_2:1638251_at:706:149; Interrogation_Position=3043; Antisense; ACTTGCAAGTCGGATGCTCCAGCTG
>probe:Drosophila_2:1638251_at:614:495; Interrogation_Position=3100; Antisense; GTCACTCCGAGTGGAGGAGCCACAT
>probe:Drosophila_2:1638251_at:80:359; Interrogation_Position=3202; Antisense; GCAACGCCTACGAAAACTGCCTTGA
>probe:Drosophila_2:1638251_at:382:109; Interrogation_Position=3230; Antisense; AGAAGACGATTGTCCCTTCAGCGGG
>probe:Drosophila_2:1638251_at:269:63; Interrogation_Position=3269; Antisense; ATGTGCCCAGCAGCCGAAGCACGGA
>probe:Drosophila_2:1638251_at:140:191; Interrogation_Position=3328; Antisense; AACATCTCGGCCAAGTCCACGAAAG
>probe:Drosophila_2:1638251_at:612:373; Interrogation_Position=3387; Antisense; GAAGTCGGCAGTGAAGCCCATCAAG
>probe:Drosophila_2:1638251_at:633:173; Interrogation_Position=3433; Antisense; AAAGCTGTGGTGTCCAAACCAGGAG
>probe:Drosophila_2:1638251_at:498:85; Interrogation_Position=3460; Antisense; AGTGCAGCCAAGACTGCAGCGGCTT
>probe:Drosophila_2:1638251_at:503:121; Interrogation_Position=3477; Antisense; AGCGGCTTCTGCTGCAACAGCGACA
>probe:Drosophila_2:1638251_at:665:139; Interrogation_Position=3544; Antisense; ACGTCGACAGCTGCAACATTGGGCA
>probe:Drosophila_2:1638251_at:300:151; Interrogation_Position=3559; Antisense; ACATTGGGCAGCCAGGCCAAGACGA
>probe:Drosophila_2:1638251_at:270:137; Interrogation_Position=3580; Antisense; ACGAAAGGCAATGCATCCGGAGCAG

Paste this into a BLAST search page for me
AACGGCCACATTATCTACTTGCAAGACTTGCAAGTCGGATGCTCCAGCTGGTCACTCCGAGTGGAGGAGCCACATGCAACGCCTACGAAAACTGCCTTGAAGAAGACGATTGTCCCTTCAGCGGGATGTGCCCAGCAGCCGAAGCACGGAAACATCTCGGCCAAGTCCACGAAAGGAAGTCGGCAGTGAAGCCCATCAAGAAAGCTGTGGTGTCCAAACCAGGAGAGTGCAGCCAAGACTGCAGCGGCTTAGCGGCTTCTGCTGCAACAGCGACAACGTCGACAGCTGCAACATTGGGCAACATTGGGCAGCCAGGCCAAGACGAACGAAAGGCAATGCATCCGGAGCAG

Full Affymetrix probeset data:

Annotations for 1638251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720