Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638252_at:

>probe:Drosophila_2:1638252_at:174:311; Interrogation_Position=1350; Antisense; CCAAGTCCTTGGACGCTGTGGTGGA
>probe:Drosophila_2:1638252_at:478:91; Interrogation_Position=1384; Antisense; AGTTTTCGGCACTAAGATCTACCTG
>probe:Drosophila_2:1638252_at:612:357; Interrogation_Position=1422; Antisense; GCAACTTCAGACAACTCAGCACGGG
>probe:Drosophila_2:1638252_at:194:557; Interrogation_Position=1450; Antisense; GGACGTCTACAGCTTCGGCATTGTG
>probe:Drosophila_2:1638252_at:155:611; Interrogation_Position=1503; Antisense; TGACGGATCGCGTGCCGGAAAACGA
>probe:Drosophila_2:1638252_at:709:107; Interrogation_Position=1533; Antisense; AGAAGAATTTGCTGGACTACGTTAA
>probe:Drosophila_2:1638252_at:453:111; Interrogation_Position=1596; Antisense; AGCACTTAGCAGCACCGATGGGCAA
>probe:Drosophila_2:1638252_at:560:557; Interrogation_Position=1627; Antisense; GGACATGTGCATGTGCGCCATCGAG
>probe:Drosophila_2:1638252_at:586:41; Interrogation_Position=1646; Antisense; ATCGAGGCGGGCTTGCACTGTACTG
>probe:Drosophila_2:1638252_at:719:545; Interrogation_Position=1684; Antisense; GGATCGCCCATCCATGAACGCGGTG
>probe:Drosophila_2:1638252_at:388:607; Interrogation_Position=1707; Antisense; TGCTCAAGCGTTTCGAACCGTTTGT
>probe:Drosophila_2:1638252_at:348:481; Interrogation_Position=1726; Antisense; GTTTGTTACCGACTAGATGGGCCTT
>probe:Drosophila_2:1638252_at:706:387; Interrogation_Position=1779; Antisense; GAAAAGCTCGAAGGACCATTTGTAA
>probe:Drosophila_2:1638252_at:11:601; Interrogation_Position=1799; Antisense; TGTAAACCATTTCCACATTTTGTGA

Paste this into a BLAST search page for me
CCAAGTCCTTGGACGCTGTGGTGGAAGTTTTCGGCACTAAGATCTACCTGGCAACTTCAGACAACTCAGCACGGGGGACGTCTACAGCTTCGGCATTGTGTGACGGATCGCGTGCCGGAAAACGAAGAAGAATTTGCTGGACTACGTTAAAGCACTTAGCAGCACCGATGGGCAAGGACATGTGCATGTGCGCCATCGAGATCGAGGCGGGCTTGCACTGTACTGGGATCGCCCATCCATGAACGCGGTGTGCTCAAGCGTTTCGAACCGTTTGTGTTTGTTACCGACTAGATGGGCCTTGAAAAGCTCGAAGGACCATTTGTAATGTAAACCATTTCCACATTTTGTGA

Full Affymetrix probeset data:

Annotations for 1638252_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime