FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638253_at:

>probe:Drosophila_2:1638253_at:257:517; Interrogation_Position=1010; Antisense; GTGGTAATTCAAAGGCCCCAAGTCT
>probe:Drosophila_2:1638253_at:444:579; Interrogation_Position=1100; Antisense; TGGAGCAATTTATACCATCGGGTAT
>probe:Drosophila_2:1638253_at:62:455; Interrogation_Position=1180; Antisense; GATCAGGATACTTTAACTCTTGTTT
>probe:Drosophila_2:1638253_at:413:415; Interrogation_Position=1209; Antisense; GACCAATGCCATTTATCCAAAACCA
>probe:Drosophila_2:1638253_at:174:175; Interrogation_Position=1228; Antisense; AAACCAAGCCTGGATGTCAGCGAAG
>probe:Drosophila_2:1638253_at:669:391; Interrogation_Position=1252; Antisense; GAAACCGAGACAATCAGCCTTCTTC
>probe:Drosophila_2:1638253_at:143:35; Interrogation_Position=1264; Antisense; ATCAGCCTTCTTCCGGAGATATTTA
>probe:Drosophila_2:1638253_at:88:177; Interrogation_Position=1312; Antisense; AAACGACTGCACCAAATGCCATCTG
>probe:Drosophila_2:1638253_at:405:171; Interrogation_Position=1337; Antisense; AAAGCTTACTTTTTGCACAGGGTGA
>probe:Drosophila_2:1638253_at:367:99; Interrogation_Position=782; Antisense; AGATGCTGAGCAGTCTGGTGCCCAA
>probe:Drosophila_2:1638253_at:600:507; Interrogation_Position=799; Antisense; GTGCCCAACACCAAATATGATCCAG
>probe:Drosophila_2:1638253_at:694:605; Interrogation_Position=816; Antisense; TGATCCAGTGGATGAGATGCTCTGC
>probe:Drosophila_2:1638253_at:601:625; Interrogation_Position=844; Antisense; TCCAACGATGGACGCAACCTGCTAA
>probe:Drosophila_2:1638253_at:37:419; Interrogation_Position=943; Antisense; GAGCTGGAGTCCCTAAATTCTAGTA

Paste this into a BLAST search page for me
GTGGTAATTCAAAGGCCCCAAGTCTTGGAGCAATTTATACCATCGGGTATGATCAGGATACTTTAACTCTTGTTTGACCAATGCCATTTATCCAAAACCAAAACCAAGCCTGGATGTCAGCGAAGGAAACCGAGACAATCAGCCTTCTTCATCAGCCTTCTTCCGGAGATATTTAAAACGACTGCACCAAATGCCATCTGAAAGCTTACTTTTTGCACAGGGTGAAGATGCTGAGCAGTCTGGTGCCCAAGTGCCCAACACCAAATATGATCCAGTGATCCAGTGGATGAGATGCTCTGCTCCAACGATGGACGCAACCTGCTAAGAGCTGGAGTCCCTAAATTCTAGTA

Full Affymetrix probeset data:

Annotations for 1638253_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720