FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638256_at:

>probe:Drosophila_2:1638256_at:35:341; Interrogation_Position=1006; Antisense; GCTACCATATTTTTCTCGGCTATTC
>probe:Drosophila_2:1638256_at:272:571; Interrogation_Position=1023; Antisense; GGCTATTCTGTTTTTGTTACCCACT
>probe:Drosophila_2:1638256_at:572:23; Interrogation_Position=1063; Antisense; ATAGTTTTTGCTGCTCTGAAGGCGC
>probe:Drosophila_2:1638256_at:325:227; Interrogation_Position=1081; Antisense; AAGGCGCTCACATTTGCTACTCTAA
>probe:Drosophila_2:1638256_at:599:483; Interrogation_Position=1137; Antisense; GTATCTCCCGATTGAAGTCTGTATA
>probe:Drosophila_2:1638256_at:309:477; Interrogation_Position=1213; Antisense; GTTTCACATCACGAAAGGGCTTTCC
>probe:Drosophila_2:1638256_at:330:81; Interrogation_Position=1228; Antisense; AGGGCTTTCCTGATGCACAAACAAC
>probe:Drosophila_2:1638256_at:469:487; Interrogation_Position=757; Antisense; GTACGACAAGTTTTCTTGGCCATTG
>probe:Drosophila_2:1638256_at:14:531; Interrogation_Position=798; Antisense; GGGTTTTACATTCCAGATAGCCTTA
>probe:Drosophila_2:1638256_at:37:729; Interrogation_Position=845; Antisense; TTGGCTTACATTCACATTGCTTCTA
>probe:Drosophila_2:1638256_at:185:215; Interrogation_Position=903; Antisense; AAGAGGTCTTTCTGTTCTATGGCAA
>probe:Drosophila_2:1638256_at:727:277; Interrogation_Position=919; Antisense; CTATGGCAAGTGGTTCGAGGCAATC
>probe:Drosophila_2:1638256_at:43:663; Interrogation_Position=956; Antisense; TAAAAGGTCGCACTGAGTCCCACAA
>probe:Drosophila_2:1638256_at:477:41; Interrogation_Position=989; Antisense; ATCGGCAATTATATCTAGCTACCAT

Paste this into a BLAST search page for me
GCTACCATATTTTTCTCGGCTATTCGGCTATTCTGTTTTTGTTACCCACTATAGTTTTTGCTGCTCTGAAGGCGCAAGGCGCTCACATTTGCTACTCTAAGTATCTCCCGATTGAAGTCTGTATAGTTTCACATCACGAAAGGGCTTTCCAGGGCTTTCCTGATGCACAAACAACGTACGACAAGTTTTCTTGGCCATTGGGGTTTTACATTCCAGATAGCCTTATTGGCTTACATTCACATTGCTTCTAAAGAGGTCTTTCTGTTCTATGGCAACTATGGCAAGTGGTTCGAGGCAATCTAAAAGGTCGCACTGAGTCCCACAAATCGGCAATTATATCTAGCTACCAT

Full Affymetrix probeset data:

Annotations for 1638256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720