FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638257_at:

>probe:Drosophila_2:1638257_at:28:41; Interrogation_Position=1011; Antisense; ATCTGAGTGTGCATATCGTGTCCTT
>probe:Drosophila_2:1638257_at:668:469; Interrogation_Position=1028; Antisense; GTGTCCTTTAGGCTAGTTTCGGTCA
>probe:Drosophila_2:1638257_at:529:91; Interrogation_Position=1042; Antisense; AGTTTCGGTCACTTTGATGTAGCAA
>probe:Drosophila_2:1638257_at:664:233; Interrogation_Position=534; Antisense; AATCCCATTGCAGAGGAGGCCATTA
>probe:Drosophila_2:1638257_at:313:579; Interrogation_Position=551; Antisense; GGCCATTAAGGCAGCGCGCGCATCA
>probe:Drosophila_2:1638257_at:220:615; Interrogation_Position=583; Antisense; TGCAATCCTTCCAGACAACAGAGCG
>probe:Drosophila_2:1638257_at:469:321; Interrogation_Position=646; Antisense; GCACCGTGTGGGAGGATACTTCGCT
>probe:Drosophila_2:1638257_at:555:77; Interrogation_Position=658; Antisense; AGGATACTTCGCTGGCTGACTGGCC
>probe:Drosophila_2:1638257_at:287:47; Interrogation_Position=688; Antisense; ATGACTTCCGCATCTTTTGTGGTGA
>probe:Drosophila_2:1638257_at:443:607; Interrogation_Position=832; Antisense; TGAGCTTCAGAGAACCGGCCGACTT
>probe:Drosophila_2:1638257_at:708:125; Interrogation_Position=897; Antisense; AGCCGGCCTATCAAACTGCGCAAGA
>probe:Drosophila_2:1638257_at:102:519; Interrogation_Position=926; Antisense; GTGGCGACAACGCAGTCTTGACGTA
>probe:Drosophila_2:1638257_at:555:181; Interrogation_Position=970; Antisense; AAAAACAGGTGCTTCTGCAGGCCTT
>probe:Drosophila_2:1638257_at:633:347; Interrogation_Position=986; Antisense; GCAGGCCTTCAATTCCATGACTTGA

Paste this into a BLAST search page for me
ATCTGAGTGTGCATATCGTGTCCTTGTGTCCTTTAGGCTAGTTTCGGTCAAGTTTCGGTCACTTTGATGTAGCAAAATCCCATTGCAGAGGAGGCCATTAGGCCATTAAGGCAGCGCGCGCATCATGCAATCCTTCCAGACAACAGAGCGGCACCGTGTGGGAGGATACTTCGCTAGGATACTTCGCTGGCTGACTGGCCATGACTTCCGCATCTTTTGTGGTGATGAGCTTCAGAGAACCGGCCGACTTAGCCGGCCTATCAAACTGCGCAAGAGTGGCGACAACGCAGTCTTGACGTAAAAAACAGGTGCTTCTGCAGGCCTTGCAGGCCTTCAATTCCATGACTTGA

Full Affymetrix probeset data:

Annotations for 1638257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720