FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638261_at:

>probe:Drosophila_2:1638261_at:186:575; Interrogation_Position=1011; Antisense; GGCGGTCTCACATGGCTATAAGTTT
>probe:Drosophila_2:1638261_at:576:119; Interrogation_Position=551; Antisense; AGCGGTACAATGTGGGTCCTGGACT
>probe:Drosophila_2:1638261_at:172:3; Interrogation_Position=646; Antisense; ATTGGAGCTCGCTGGTTAACCTTAG
>probe:Drosophila_2:1638261_at:43:605; Interrogation_Position=707; Antisense; TGATCACCAAAGTCTTACCACTCTT
>probe:Drosophila_2:1638261_at:387:237; Interrogation_Position=752; Antisense; AATCGGCCATTGTTCCATTTCTGGT
>probe:Drosophila_2:1638261_at:158:589; Interrogation_Position=773; Antisense; TGGTCACCAAGCTGAAACTGCTCCT
>probe:Drosophila_2:1638261_at:72:195; Interrogation_Position=788; Antisense; AACTGCTCCTGGTCAAATCGATTCT
>probe:Drosophila_2:1638261_at:570:41; Interrogation_Position=804; Antisense; ATCGATTCTTGTGGGCAAGCTGGCC
>probe:Drosophila_2:1638261_at:557:621; Interrogation_Position=836; Antisense; TGCTGATCATCTCGGCCATCAAGAA
>probe:Drosophila_2:1638261_at:428:65; Interrogation_Position=871; Antisense; ATGGTCCAGAGCTACGAAGTGCCCT
>probe:Drosophila_2:1638261_at:206:667; Interrogation_Position=898; Antisense; TACTGGGCCGGCGAACCAAGTCGGA
>probe:Drosophila_2:1638261_at:606:623; Interrogation_Position=957; Antisense; TGCCGCATACAATGGCTATCGGGTG
>probe:Drosophila_2:1638261_at:328:585; Interrogation_Position=980; Antisense; TGGAGGGTAAGCCAACCACCTGGAT
>probe:Drosophila_2:1638261_at:489:287; Interrogation_Position=999; Antisense; CTGGATCAGCTAGGCGGTCTCACAT

Paste this into a BLAST search page for me
GGCGGTCTCACATGGCTATAAGTTTAGCGGTACAATGTGGGTCCTGGACTATTGGAGCTCGCTGGTTAACCTTAGTGATCACCAAAGTCTTACCACTCTTAATCGGCCATTGTTCCATTTCTGGTTGGTCACCAAGCTGAAACTGCTCCTAACTGCTCCTGGTCAAATCGATTCTATCGATTCTTGTGGGCAAGCTGGCCTGCTGATCATCTCGGCCATCAAGAAATGGTCCAGAGCTACGAAGTGCCCTTACTGGGCCGGCGAACCAAGTCGGATGCCGCATACAATGGCTATCGGGTGTGGAGGGTAAGCCAACCACCTGGATCTGGATCAGCTAGGCGGTCTCACAT

Full Affymetrix probeset data:

Annotations for 1638261_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720