Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638262_at:

>probe:Drosophila_2:1638262_at:576:387; Interrogation_Position=122; Antisense; GAAAATCCACGTTGACAGACCGCCT
>probe:Drosophila_2:1638262_at:563:411; Interrogation_Position=139; Antisense; GACCGCCTGGCGGAAATTTTCAATG
>probe:Drosophila_2:1638262_at:37:553; Interrogation_Position=200; Antisense; GGAGCTTCACCATAAATAATTTCAG
>probe:Drosophila_2:1638262_at:530:313; Interrogation_Position=263; Antisense; GCCAGATCTGGCCAAAGTATTATAA
>probe:Drosophila_2:1638262_at:626:457; Interrogation_Position=316; Antisense; GATAGCACGGATGCACTGCGGCTAA
>probe:Drosophila_2:1638262_at:469:205; Interrogation_Position=339; Antisense; AAGCGAGGCGCGATGTGTTTTATGC
>probe:Drosophila_2:1638262_at:709:623; Interrogation_Position=361; Antisense; TGCGATGTTTTGATGCACCAGGAAC
>probe:Drosophila_2:1638262_at:551:383; Interrogation_Position=382; Antisense; GAACTGGATAATGCTCCGCTGCTGA
>probe:Drosophila_2:1638262_at:463:209; Interrogation_Position=418; Antisense; AAGAAGGACGCCTCGGGATCCCTGT
>probe:Drosophila_2:1638262_at:74:597; Interrogation_Position=440; Antisense; TGTCCATGTCCACGGTTATCGATTT
>probe:Drosophila_2:1638262_at:553:459; Interrogation_Position=460; Antisense; GATTTGATGGGCCTATATCGCCTAA
>probe:Drosophila_2:1638262_at:111:45; Interrogation_Position=476; Antisense; ATCGCCTAACTGGTCGAGATTGGAC
>probe:Drosophila_2:1638262_at:640:59; Interrogation_Position=510; Antisense; ATGTTCCATGCGGACAGGGTCTGGT
>probe:Drosophila_2:1638262_at:359:395; Interrogation_Position=84; Antisense; GAAATCATGTCTGCTCATTTTAGGA

Paste this into a BLAST search page for me
GAAAATCCACGTTGACAGACCGCCTGACCGCCTGGCGGAAATTTTCAATGGGAGCTTCACCATAAATAATTTCAGGCCAGATCTGGCCAAAGTATTATAAGATAGCACGGATGCACTGCGGCTAAAAGCGAGGCGCGATGTGTTTTATGCTGCGATGTTTTGATGCACCAGGAACGAACTGGATAATGCTCCGCTGCTGAAAGAAGGACGCCTCGGGATCCCTGTTGTCCATGTCCACGGTTATCGATTTGATTTGATGGGCCTATATCGCCTAAATCGCCTAACTGGTCGAGATTGGACATGTTCCATGCGGACAGGGTCTGGTGAAATCATGTCTGCTCATTTTAGGA

Full Affymetrix probeset data:

Annotations for 1638262_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime