Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638264_at:

>probe:Drosophila_2:1638264_at:598:259; Interrogation_Position=463; Antisense; CACTGCGGATACTCCAGCGGATGTG
>probe:Drosophila_2:1638264_at:175:29; Interrogation_Position=471; Antisense; ATACTCCAGCGGATGTGGACGTCAT
>probe:Drosophila_2:1638264_at:339:519; Interrogation_Position=485; Antisense; GTGGACGTCATCATTTCCGGCTGGG
>probe:Drosophila_2:1638264_at:565:89; Interrogation_Position=549; Antisense; AGTACAACACCCTGAAGTCCATTTC
>probe:Drosophila_2:1638264_at:71:133; Interrogation_Position=557; Antisense; ACCCTGAAGTCCATTTCCTTGGAGA
>probe:Drosophila_2:1638264_at:679:621; Interrogation_Position=572; Antisense; TCCTTGGAGAGGTGCGACGAACTGA
>probe:Drosophila_2:1638264_at:245:103; Interrogation_Position=612; Antisense; AGAGCGAGTTGTGCCTCATCCACGA
>probe:Drosophila_2:1638264_at:91:295; Interrogation_Position=634; Antisense; CGAGGCCGATAATGGAGCGTGCAAT
>probe:Drosophila_2:1638264_at:653:517; Interrogation_Position=718; Antisense; GTGGTCCGCCTGTGGAACGAGCTAT
>probe:Drosophila_2:1638264_at:98:685; Interrogation_Position=740; Antisense; TATCCAGATGGATATGCCAGGGTGT
>probe:Drosophila_2:1638264_at:258:601; Interrogation_Position=762; Antisense; TGTACTACCACAACGAATGGATTAA
>probe:Drosophila_2:1638264_at:370:193; Interrogation_Position=791; Antisense; AACTCGGATGTGAAATAATGCTGGC
>probe:Drosophila_2:1638264_at:570:331; Interrogation_Position=810; Antisense; GCTGGCATAGCTGTATTGAGGGAAT
>probe:Drosophila_2:1638264_at:526:655; Interrogation_Position=862; Antisense; TAAGAATTGTTTGTGTTGACTATCA

Paste this into a BLAST search page for me
CACTGCGGATACTCCAGCGGATGTGATACTCCAGCGGATGTGGACGTCATGTGGACGTCATCATTTCCGGCTGGGAGTACAACACCCTGAAGTCCATTTCACCCTGAAGTCCATTTCCTTGGAGATCCTTGGAGAGGTGCGACGAACTGAAGAGCGAGTTGTGCCTCATCCACGACGAGGCCGATAATGGAGCGTGCAATGTGGTCCGCCTGTGGAACGAGCTATTATCCAGATGGATATGCCAGGGTGTTGTACTACCACAACGAATGGATTAAAACTCGGATGTGAAATAATGCTGGCGCTGGCATAGCTGTATTGAGGGAATTAAGAATTGTTTGTGTTGACTATCA

Full Affymetrix probeset data:

Annotations for 1638264_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime