Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638265_s_at:

>probe:Drosophila_2:1638265_s_at:101:135; Interrogation_Position=1002; Antisense; ACGCTGCAAAAGCACGGCCTCAAGT
>probe:Drosophila_2:1638265_s_at:89:221; Interrogation_Position=1023; Antisense; AAGTGCACCCACATCGTTCGGCAGA
>probe:Drosophila_2:1638265_s_at:436:41; Interrogation_Position=1035; Antisense; ATCGTTCGGCAGATCCGCAAGCAGG
>probe:Drosophila_2:1638265_s_at:211:361; Interrogation_Position=1051; Antisense; GCAAGCAGGACTTCTCGGAATTCGA
>probe:Drosophila_2:1638265_s_at:429:11; Interrogation_Position=1070; Antisense; ATTCGACTACATCTTCGGCATGGAC
>probe:Drosophila_2:1638265_s_at:74:153; Interrogation_Position=1102; Antisense; ACATGAGCGAGCTAAGGCGTCTGGC
>probe:Drosophila_2:1638265_s_at:220:553; Interrogation_Position=1145; Antisense; GGAGCTCCTCATGCTGGGCGATTTC
>probe:Drosophila_2:1638265_s_at:505:381; Interrogation_Position=1184; Antisense; GAACCGCATCATTGAGGATCCCTAC
>probe:Drosophila_2:1638265_s_at:694:561; Interrogation_Position=754; Antisense; GGAACGCTCAATTGCGAGCCGGAAA
>probe:Drosophila_2:1638265_s_at:593:9; Interrogation_Position=807; Antisense; ATTCCCGTGTAAATTGACTCAAAGA
>probe:Drosophila_2:1638265_s_at:498:721; Interrogation_Position=854; Antisense; TTGTTTGGGCAACATCTGCAGGTCC
>probe:Drosophila_2:1638265_s_at:567:61; Interrogation_Position=873; Antisense; AGGTCCCCAATTGCGGAGGTCGTGA
>probe:Drosophila_2:1638265_s_at:460:139; Interrogation_Position=931; Antisense; ACGTGGAGGTCGATAGTGCAGCAAT
>probe:Drosophila_2:1638265_s_at:82:585; Interrogation_Position=963; Antisense; TGGCACGTGGGCAACCGCGCAGATC

Paste this into a BLAST search page for me
ACGCTGCAAAAGCACGGCCTCAAGTAAGTGCACCCACATCGTTCGGCAGAATCGTTCGGCAGATCCGCAAGCAGGGCAAGCAGGACTTCTCGGAATTCGAATTCGACTACATCTTCGGCATGGACACATGAGCGAGCTAAGGCGTCTGGCGGAGCTCCTCATGCTGGGCGATTTCGAACCGCATCATTGAGGATCCCTACGGAACGCTCAATTGCGAGCCGGAAAATTCCCGTGTAAATTGACTCAAAGATTGTTTGGGCAACATCTGCAGGTCCAGGTCCCCAATTGCGGAGGTCGTGAACGTGGAGGTCGATAGTGCAGCAATTGGCACGTGGGCAACCGCGCAGATC

Full Affymetrix probeset data:

Annotations for 1638265_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime