Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638268_at:

>probe:Drosophila_2:1638268_at:127:301; Interrogation_Position=2946; Antisense; CGCCAAAGCTCAGTAAAAATTGTAT
>probe:Drosophila_2:1638268_at:95:161; Interrogation_Position=2962; Antisense; AAATTGTATCATTGTATCACTTAAG
>probe:Drosophila_2:1638268_at:696:481; Interrogation_Position=2967; Antisense; GTATCATTGTATCACTTAAGTAGAA
>probe:Drosophila_2:1638268_at:489:663; Interrogation_Position=3016; Antisense; TAAATATATTTTGGCTTACGCTAAG
>probe:Drosophila_2:1638268_at:449:715; Interrogation_Position=3026; Antisense; TTGGCTTACGCTAAGAAAGTTTAGT
>probe:Drosophila_2:1638268_at:653:465; Interrogation_Position=3057; Antisense; GATTGTGCACTTATAATGCTGGATC
>probe:Drosophila_2:1638268_at:228:617; Interrogation_Position=3062; Antisense; TGCACTTATAATGCTGGATCTGCGG
>probe:Drosophila_2:1638268_at:448:545; Interrogation_Position=3077; Antisense; GGATCTGCGGAGAATTTCCAATATA
>probe:Drosophila_2:1638268_at:670:551; Interrogation_Position=3085; Antisense; GGAGAATTTCCAATATAACAAAGTT
>probe:Drosophila_2:1638268_at:257:459; Interrogation_Position=3118; Antisense; GATATCTAAACGAATTTGGCGCAGC
>probe:Drosophila_2:1638268_at:45:643; Interrogation_Position=3122; Antisense; TCTAAACGAATTTGGCGCAGCCTCA
>probe:Drosophila_2:1638268_at:359:365; Interrogation_Position=3129; Antisense; GAATTTGGCGCAGCCTCATTTTAGA
>probe:Drosophila_2:1638268_at:246:577; Interrogation_Position=3135; Antisense; GGCGCAGCCTCATTTTAGAGGAGAA
>probe:Drosophila_2:1638268_at:35:437; Interrogation_Position=3152; Antisense; GAGGAGAATTCATTTAACATGTACA

Paste this into a BLAST search page for me
CGCCAAAGCTCAGTAAAAATTGTATAAATTGTATCATTGTATCACTTAAGGTATCATTGTATCACTTAAGTAGAATAAATATATTTTGGCTTACGCTAAGTTGGCTTACGCTAAGAAAGTTTAGTGATTGTGCACTTATAATGCTGGATCTGCACTTATAATGCTGGATCTGCGGGGATCTGCGGAGAATTTCCAATATAGGAGAATTTCCAATATAACAAAGTTGATATCTAAACGAATTTGGCGCAGCTCTAAACGAATTTGGCGCAGCCTCAGAATTTGGCGCAGCCTCATTTTAGAGGCGCAGCCTCATTTTAGAGGAGAAGAGGAGAATTCATTTAACATGTACA

Full Affymetrix probeset data:

Annotations for 1638268_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime