FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638270_at:

>probe:Drosophila_2:1638270_at:302:577; Interrogation_Position=1132; Antisense; GGCGCTCCGAGCTACAGGAGTTCGA
>probe:Drosophila_2:1638270_at:494:281; Interrogation_Position=1190; Antisense; CTCCGATGGATCCTCGATCTTGGAT
>probe:Drosophila_2:1638270_at:8:547; Interrogation_Position=1211; Antisense; GGATCGGGCTGTTTTCGAGCACAAT
>probe:Drosophila_2:1638270_at:584:421; Interrogation_Position=1227; Antisense; GAGCACAATCTGTTGTCGGCTAGTA
>probe:Drosophila_2:1638270_at:402:271; Interrogation_Position=1265; Antisense; CATAACTTTTGAGGAGCTAGGCGCT
>probe:Drosophila_2:1638270_at:232:465; Interrogation_Position=1322; Antisense; GATTGCCTCTCAGATGATTACCGAA
>probe:Drosophila_2:1638270_at:657:613; Interrogation_Position=1354; Antisense; TGAACGGACACATCGACCAGATCTC
>probe:Drosophila_2:1638270_at:118:307; Interrogation_Position=1381; Antisense; CCATTGTGCACTTCGAGAATCGGGA
>probe:Drosophila_2:1638270_at:148:111; Interrogation_Position=1396; Antisense; AGAATCGGGAACTACTGCCTCAGTG
>probe:Drosophila_2:1638270_at:33:97; Interrogation_Position=1429; Antisense; AGATCCAGTCGCTATGCTATCAGGT
>probe:Drosophila_2:1638270_at:49:375; Interrogation_Position=1469; Antisense; GAAGATAAGTGTCGCCGAGCCCGAT
>probe:Drosophila_2:1638270_at:324:613; Interrogation_Position=1507; Antisense; TGAACTGAAGCAGGCTCTCGCCATC
>probe:Drosophila_2:1638270_at:100:303; Interrogation_Position=1599; Antisense; CCCCGACTGCGATAGATTTCATTTT
>probe:Drosophila_2:1638270_at:7:491; Interrogation_Position=1650; Antisense; GTACATTATCGATCCTGTGGAACCA

Paste this into a BLAST search page for me
GGCGCTCCGAGCTACAGGAGTTCGACTCCGATGGATCCTCGATCTTGGATGGATCGGGCTGTTTTCGAGCACAATGAGCACAATCTGTTGTCGGCTAGTACATAACTTTTGAGGAGCTAGGCGCTGATTGCCTCTCAGATGATTACCGAATGAACGGACACATCGACCAGATCTCCCATTGTGCACTTCGAGAATCGGGAAGAATCGGGAACTACTGCCTCAGTGAGATCCAGTCGCTATGCTATCAGGTGAAGATAAGTGTCGCCGAGCCCGATTGAACTGAAGCAGGCTCTCGCCATCCCCCGACTGCGATAGATTTCATTTTGTACATTATCGATCCTGTGGAACCA

Full Affymetrix probeset data:

Annotations for 1638270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720