FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638272_at:

>probe:Drosophila_2:1638272_at:390:369; Interrogation_Position=104; Antisense; GAATGGCGACAGCAGTTCCCATGAA
>probe:Drosophila_2:1638272_at:421:553; Interrogation_Position=137; Antisense; GGAGCCCCAGCATGAAACACAACGA
>probe:Drosophila_2:1638272_at:32:21; Interrogation_Position=175; Antisense; ATTTGCATATATCCCGCCTACATCA
>probe:Drosophila_2:1638272_at:533:383; Interrogation_Position=243; Antisense; GAACTGTGTAGACAATCCCAGCTAT
>probe:Drosophila_2:1638272_at:553:3; Interrogation_Position=268; Antisense; ATTGAGATTCGCGATGTGCTGTCCG
>probe:Drosophila_2:1638272_at:606:479; Interrogation_Position=292; Antisense; GTTTCCAACTTGCAGTTCCTCATGG
>probe:Drosophila_2:1638272_at:199:327; Interrogation_Position=374; Antisense; GCGTCCAGCTGCGTAATGTCGATGG
>probe:Drosophila_2:1638272_at:97:491; Interrogation_Position=405; Antisense; GTACAATAATGACTTTCCCACGCGC
>probe:Drosophila_2:1638272_at:611:431; Interrogation_Position=430; Antisense; GAGTCCATCATGCTGCATATCGCCA
>probe:Drosophila_2:1638272_at:368:23; Interrogation_Position=446; Antisense; ATATCGCCAGCAAGATACCGCAGCT
>probe:Drosophila_2:1638272_at:706:399; Interrogation_Position=479; Antisense; GACAGAACAAATCCGGCGACTCGTA
>probe:Drosophila_2:1638272_at:537:127; Interrogation_Position=518; Antisense; AGCCACAGTCGAATGCATCCGGATC
>probe:Drosophila_2:1638272_at:347:357; Interrogation_Position=575; Antisense; GCAAGCGCCGCTAATGACTTCAGTG
>probe:Drosophila_2:1638272_at:345:611; Interrogation_Position=589; Antisense; TGACTTCAGTGGCAACTCGTTGTTT

Paste this into a BLAST search page for me
GAATGGCGACAGCAGTTCCCATGAAGGAGCCCCAGCATGAAACACAACGAATTTGCATATATCCCGCCTACATCAGAACTGTGTAGACAATCCCAGCTATATTGAGATTCGCGATGTGCTGTCCGGTTTCCAACTTGCAGTTCCTCATGGGCGTCCAGCTGCGTAATGTCGATGGGTACAATAATGACTTTCCCACGCGCGAGTCCATCATGCTGCATATCGCCAATATCGCCAGCAAGATACCGCAGCTGACAGAACAAATCCGGCGACTCGTAAGCCACAGTCGAATGCATCCGGATCGCAAGCGCCGCTAATGACTTCAGTGTGACTTCAGTGGCAACTCGTTGTTT

Full Affymetrix probeset data:

Annotations for 1638272_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720