Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638273_at:

>probe:Drosophila_2:1638273_at:9:707; Interrogation_Position=1947; Antisense; TTATGGCGCCATGGATATACGAAAA
>probe:Drosophila_2:1638273_at:174:351; Interrogation_Position=2016; Antisense; GCAGCCTTTGTTGCCGGAGTCGGAC
>probe:Drosophila_2:1638273_at:373:639; Interrogation_Position=2035; Antisense; TCGGACTATCAAGACTCGCAGCGCT
>probe:Drosophila_2:1638273_at:671:501; Interrogation_Position=2064; Antisense; GTCGCATCCGTCACACGAGACAGGA
>probe:Drosophila_2:1638273_at:593:661; Interrogation_Position=2148; Antisense; TAAAAGCCAGCGACGCCGTGCGTAT
>probe:Drosophila_2:1638273_at:234:689; Interrogation_Position=2170; Antisense; TATTGTGCGGCTTGTTTAGGCGGTC
>probe:Drosophila_2:1638273_at:188:535; Interrogation_Position=2191; Antisense; GGTCCTGTCATCAGTCAGCGAACAA
>probe:Drosophila_2:1638273_at:457:183; Interrogation_Position=2214; Antisense; AAAAGCGAGGCATCCTTCGGCTGCA
>probe:Drosophila_2:1638273_at:375:715; Interrogation_Position=2229; Antisense; TTCGGCTGCAAGGAGTCAGTCGCAA
>probe:Drosophila_2:1638273_at:28:467; Interrogation_Position=2264; Antisense; GTTGATGACAATGCCACTGACTGCC
>probe:Drosophila_2:1638273_at:635:633; Interrogation_Position=2293; Antisense; TCGCGCTTCCGGCAATTTTGATGGC
>probe:Drosophila_2:1638273_at:502:245; Interrogation_Position=2306; Antisense; AATTTTGATGGCCTCCGGATGCCGG
>probe:Drosophila_2:1638273_at:638:109; Interrogation_Position=2422; Antisense; AGAAGTTCATGGTGTGGCTGCCGTT
>probe:Drosophila_2:1638273_at:115:477; Interrogation_Position=2483; Antisense; GTTTTGTTTCACCATTCTTGCGGTA

Paste this into a BLAST search page for me
TTATGGCGCCATGGATATACGAAAAGCAGCCTTTGTTGCCGGAGTCGGACTCGGACTATCAAGACTCGCAGCGCTGTCGCATCCGTCACACGAGACAGGATAAAAGCCAGCGACGCCGTGCGTATTATTGTGCGGCTTGTTTAGGCGGTCGGTCCTGTCATCAGTCAGCGAACAAAAAAGCGAGGCATCCTTCGGCTGCATTCGGCTGCAAGGAGTCAGTCGCAAGTTGATGACAATGCCACTGACTGCCTCGCGCTTCCGGCAATTTTGATGGCAATTTTGATGGCCTCCGGATGCCGGAGAAGTTCATGGTGTGGCTGCCGTTGTTTTGTTTCACCATTCTTGCGGTA

Full Affymetrix probeset data:

Annotations for 1638273_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime