FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638275_at:

>probe:Drosophila_2:1638275_at:593:371; Interrogation_Position=140; Antisense; GAAGGAGCGCAAGTTCCGCATCCAG
>probe:Drosophila_2:1638275_at:727:407; Interrogation_Position=242; Antisense; GACGGATAGCAAGGTCCTCCAGCAG
>probe:Drosophila_2:1638275_at:72:201; Interrogation_Position=272; Antisense; AACGCGGCAAGGCATGATCCTGATG
>probe:Drosophila_2:1638275_at:73:277; Interrogation_Position=368; Antisense; CTTCTGCTACGGCTTCTGGAAGCTA
>probe:Drosophila_2:1638275_at:550:341; Interrogation_Position=379; Antisense; GCTTCTGGAAGCTATCCGGAGCCAA
>probe:Drosophila_2:1638275_at:510:71; Interrogation_Position=412; Antisense; AGGAGTTCCGCCTCAAGATGGGCAA
>probe:Drosophila_2:1638275_at:136:233; Interrogation_Position=435; Antisense; AATGCACTGCCAAGAATCACCAAGG
>probe:Drosophila_2:1638275_at:383:125; Interrogation_Position=474; Antisense; AGCCGCACCGATTTCGAGAGTCTCA
>probe:Drosophila_2:1638275_at:112:427; Interrogation_Position=489; Antisense; GAGAGTCTCACGGACCTCATGAAAT
>probe:Drosophila_2:1638275_at:501:413; Interrogation_Position=501; Antisense; GACCTCATGAAATACCTGGCAGCCT
>probe:Drosophila_2:1638275_at:379:673; Interrogation_Position=513; Antisense; TACCTGGCAGCCTGGAACAAGGAAT
>probe:Drosophila_2:1638275_at:637:715; Interrogation_Position=53; Antisense; TTCGGGCATTAGTAGTTACGACAAC
>probe:Drosophila_2:1638275_at:495:209; Interrogation_Position=538; Antisense; AAGCAGCTCACAAATATACACACAA
>probe:Drosophila_2:1638275_at:59:171; Interrogation_Position=566; Antisense; AAAGTAGACCTAACGCCTGAGTAGA

Paste this into a BLAST search page for me
GAAGGAGCGCAAGTTCCGCATCCAGGACGGATAGCAAGGTCCTCCAGCAGAACGCGGCAAGGCATGATCCTGATGCTTCTGCTACGGCTTCTGGAAGCTAGCTTCTGGAAGCTATCCGGAGCCAAAGGAGTTCCGCCTCAAGATGGGCAAAATGCACTGCCAAGAATCACCAAGGAGCCGCACCGATTTCGAGAGTCTCAGAGAGTCTCACGGACCTCATGAAATGACCTCATGAAATACCTGGCAGCCTTACCTGGCAGCCTGGAACAAGGAATTTCGGGCATTAGTAGTTACGACAACAAGCAGCTCACAAATATACACACAAAAAGTAGACCTAACGCCTGAGTAGA

Full Affymetrix probeset data:

Annotations for 1638275_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720