FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638276_at:

>probe:Drosophila_2:1638276_at:622:569; Interrogation_Position=123; Antisense; GGCTAACTGATTCCCAAAAGGCTGA
>probe:Drosophila_2:1638276_at:463:423; Interrogation_Position=157; Antisense; GAGAGCCAAGGCCTGCGTCAAACAG
>probe:Drosophila_2:1638276_at:282:225; Interrogation_Position=194; Antisense; AAGGAGCAAGCTATTGCCCTGCGGT
>probe:Drosophila_2:1638276_at:280:9; Interrogation_Position=206; Antisense; ATTGCCCTGCGGTCTGGAAACTTTG
>probe:Drosophila_2:1638276_at:16:561; Interrogation_Position=221; Antisense; GGAAACTTTGCAGACTCCGATCCAA
>probe:Drosophila_2:1638276_at:79:223; Interrogation_Position=245; Antisense; AAGGTAAAGTGCTTCGCCAACTGCT
>probe:Drosophila_2:1638276_at:36:569; Interrogation_Position=318; Antisense; TGGTTTTGGCCAAACTAGGTCCCAT
>probe:Drosophila_2:1638276_at:488:45; Interrogation_Position=341; Antisense; ATCGCCGGCGAAGCCAATGTCAAGG
>probe:Drosophila_2:1638276_at:347:613; Interrogation_Position=369; Antisense; TGCAGGCCAAGTGTGACTCGACCAA
>probe:Drosophila_2:1638276_at:139:223; Interrogation_Position=392; Antisense; AAGGGAGCCGACAAGTGCGACACTA
>probe:Drosophila_2:1638276_at:439:325; Interrogation_Position=408; Antisense; GCGACACTAGCTATCTGCTGTACAA
>probe:Drosophila_2:1638276_at:351:35; Interrogation_Position=533; Antisense; ATCAGGCTTCCCAAATAGGCGTGCA
>probe:Drosophila_2:1638276_at:515:217; Interrogation_Position=69; Antisense; AAGTATTCTTTGTGTTTGCCGCCCT
>probe:Drosophila_2:1638276_at:29:275; Interrogation_Position=92; Antisense; CTTGCAGCTCTATCTTTGGCATCTG

Paste this into a BLAST search page for me
GGCTAACTGATTCCCAAAAGGCTGAGAGAGCCAAGGCCTGCGTCAAACAGAAGGAGCAAGCTATTGCCCTGCGGTATTGCCCTGCGGTCTGGAAACTTTGGGAAACTTTGCAGACTCCGATCCAAAAGGTAAAGTGCTTCGCCAACTGCTTGGTTTTGGCCAAACTAGGTCCCATATCGCCGGCGAAGCCAATGTCAAGGTGCAGGCCAAGTGTGACTCGACCAAAAGGGAGCCGACAAGTGCGACACTAGCGACACTAGCTATCTGCTGTACAAATCAGGCTTCCCAAATAGGCGTGCAAAGTATTCTTTGTGTTTGCCGCCCTCTTGCAGCTCTATCTTTGGCATCTG

Full Affymetrix probeset data:

Annotations for 1638276_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720