FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638277_at:

>probe:Drosophila_2:1638277_at:231:207; Interrogation_Position=403; Antisense; AAGGATACCGGGTGATTCTCGCCAA
>probe:Drosophila_2:1638277_at:44:715; Interrogation_Position=418; Antisense; TTCTCGCCAAGCTTGATGACCTGAA
>probe:Drosophila_2:1638277_at:304:377; Interrogation_Position=473; Antisense; GAAGCTCTATTGCATGGTGTTTGAC
>probe:Drosophila_2:1638277_at:589:273; Interrogation_Position=518; Antisense; CATTCAGCCGGGACACGTTATTGTA
>probe:Drosophila_2:1638277_at:248:675; Interrogation_Position=574; Antisense; TAGCCCGCATTGGACTCTTGCAAAT
>probe:Drosophila_2:1638277_at:662:375; Interrogation_Position=599; Antisense; GAAGAAGTTCCTTTACTACCTGCAG
>probe:Drosophila_2:1638277_at:279:379; Interrogation_Position=624; Antisense; GAAGCGGCTGCCATCCGGTTGATAG
>probe:Drosophila_2:1638277_at:419:25; Interrogation_Position=645; Antisense; ATAGGCTTTCACTTCATCAACATTG
>probe:Drosophila_2:1638277_at:511:487; Interrogation_Position=669; Antisense; GTACCGTTCATGGACAAGATTCTTG
>probe:Drosophila_2:1638277_at:538:719; Interrogation_Position=691; Antisense; TTGCGCTGATGACTCCGTTTATGAA
>probe:Drosophila_2:1638277_at:371:169; Interrogation_Position=716; Antisense; AAAGGAACTGACCACTGTGCTCCAT
>probe:Drosophila_2:1638277_at:278:217; Interrogation_Position=768; Antisense; AAGTTTGTGCCCCAGGAAATGCTTC
>probe:Drosophila_2:1638277_at:45:431; Interrogation_Position=882; Antisense; GAGTTTGAGACTCGCCACCAGGTGA
>probe:Drosophila_2:1638277_at:185:3; Interrogation_Position=914; Antisense; ATTGCGACCCGGCAAGGCCAAGAAT

Paste this into a BLAST search page for me
AAGGATACCGGGTGATTCTCGCCAATTCTCGCCAAGCTTGATGACCTGAAGAAGCTCTATTGCATGGTGTTTGACCATTCAGCCGGGACACGTTATTGTATAGCCCGCATTGGACTCTTGCAAATGAAGAAGTTCCTTTACTACCTGCAGGAAGCGGCTGCCATCCGGTTGATAGATAGGCTTTCACTTCATCAACATTGGTACCGTTCATGGACAAGATTCTTGTTGCGCTGATGACTCCGTTTATGAAAAAGGAACTGACCACTGTGCTCCATAAGTTTGTGCCCCAGGAAATGCTTCGAGTTTGAGACTCGCCACCAGGTGAATTGCGACCCGGCAAGGCCAAGAAT

Full Affymetrix probeset data:

Annotations for 1638277_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720