Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638281_at:

>probe:Drosophila_2:1638281_at:371:145; Interrogation_Position=129; Antisense; ACTAATCCCCTACTACAAATTTGCG
>probe:Drosophila_2:1638281_at:146:159; Interrogation_Position=145; Antisense; AAATTTGCGCCTCACCTACTATTCG
>probe:Drosophila_2:1638281_at:350:279; Interrogation_Position=160; Antisense; CTACTATTCGCCCTATTCGGCTTCA
>probe:Drosophila_2:1638281_at:581:689; Interrogation_Position=173; Antisense; TATTCGGCTTCACCTGCTCGGGATT
>probe:Drosophila_2:1638281_at:92:621; Interrogation_Position=187; Antisense; TGCTCGGGATTGGTTTTGTTCTTCC
>probe:Drosophila_2:1638281_at:697:599; Interrogation_Position=20; Antisense; TGTACTTCTTCACCTCCGAGATCTT
>probe:Drosophila_2:1638281_at:674:725; Interrogation_Position=202; Antisense; TTGTTCTTCCCGGAGACAACCAACA
>probe:Drosophila_2:1638281_at:52:289; Interrogation_Position=212; Antisense; CGGAGACAACCAACAAGGTGCTGCC
>probe:Drosophila_2:1638281_at:18:625; Interrogation_Position=233; Antisense; TGCCCACCACGCTGGCTGAATCTTG
>probe:Drosophila_2:1638281_at:209:97; Interrogation_Position=38; Antisense; AGATCTTTCCCACCAACTGCAGGAA
>probe:Drosophila_2:1638281_at:704:617; Interrogation_Position=55; Antisense; TGCAGGAACAGCATGCTCTCCTCCT
>probe:Drosophila_2:1638281_at:83:641; Interrogation_Position=71; Antisense; TCTCCTCCTGCTCAAGTATGGGTCG
>probe:Drosophila_2:1638281_at:415:653; Interrogation_Position=82; Antisense; TCAAGTATGGGTCGCTTTGGCTCCA
>probe:Drosophila_2:1638281_at:260:65; Interrogation_Position=88; Antisense; ATGGGTCGCTTTGGCTCCATGCTGT

Paste this into a BLAST search page for me
ACTAATCCCCTACTACAAATTTGCGAAATTTGCGCCTCACCTACTATTCGCTACTATTCGCCCTATTCGGCTTCATATTCGGCTTCACCTGCTCGGGATTTGCTCGGGATTGGTTTTGTTCTTCCTGTACTTCTTCACCTCCGAGATCTTTTGTTCTTCCCGGAGACAACCAACACGGAGACAACCAACAAGGTGCTGCCTGCCCACCACGCTGGCTGAATCTTGAGATCTTTCCCACCAACTGCAGGAATGCAGGAACAGCATGCTCTCCTCCTTCTCCTCCTGCTCAAGTATGGGTCGTCAAGTATGGGTCGCTTTGGCTCCAATGGGTCGCTTTGGCTCCATGCTGT

Full Affymetrix probeset data:

Annotations for 1638281_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime